Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1068
Length(NT) : 731
Best Gene Model Blast : Link to GSTUMT00004248001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_10235
Accession: ref|XP_001239213.1| Score: 273 E_value: 2e-22
KEGG Definition: predicted protein
Accession: aor:AO090003000461 Score: 248 E_value: 6e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1068
AGGAACTCATGCATGGTGATGTTTCGCGAGCGGTCCGTGTGCTTTTATCG
ATTGATACTGGGAGGCTATTGATAGATGGAGATGATGAGTTGAATTCACG
TGGGCTTCCATCGGCCTTAGTGCTGAAGGCTCGAAGGCATTTGGAGGACT
CAAAAGGGTTGATGCTTTCTCTCGGCCGTGTCAACCATGCAATCGCCTTT
GTCGAAACGAGGGCCCTACTTGAGTACCTTGTTTCTAATCGAGAAGTGGC
GGCATCGTTGCCAATATATGCCGACTTCCTTTCCGAGCTTGATAGACGCG
GTCTGTGCGGTCCAAATTCGGCAGTTCATGAAAGGTGTTTGATGACAGAA
GCGAGGTTACTATACTATCACTCAAGTACCTCACGACTATTCAAAATTAA
GACCATGAGAGACTTTCTTAATAACTCTCTGCAAATGTTTCCGAATAATT
CTGTTTTTTTGGAATTGTTCGTTCGGAACGAGGCAAAGACCAAAATAGAA
AACAGGACCAGGATGCTCATGCGAGATGTAGTATTAAAGGAAGGGTCAGA
GACAATCCTGGGATATGGCTTTGCTATATGGGCAGAAATGCGAATGATAG
GCGCAGGCGGGCGTTACAATCCCCACGCTGTTCGAGCTTTGTTCGAACAG
GCAGTGGAAACCGACAGGACAAAATATAATTTCGGTTTGTGGGCGATATA
CGTGGGGTTTGAAATCCAAGAGAGAGAATTG

Sequences in the Contig:

SY0AAA41YB12FM1 SY0AAD12YF15FM1