Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1066
Length(NT) : 1605
Best Gene Model Blast : Link to GSTUMT00000195001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_04242
Accession: ref|XP_001594435.1| Score: 1748 E_value: 0.0
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG00524.1 Score: 1686 E_value: 0.0
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2638 Score: 1613 E_value: 1e-180
PFAM Definition: UDPGP, UTP--glucose-1-phosphate uridylyltransferase. This family consists of UTP--glucose-1-phosphate uridylyltransferases, EC:2.7.7.9. Also known as UDP-glucose pyrophosphorylase (UDPGP) and Glucose-1-phosphate uridylyltransferase. UTP--glucose-1-phosphate uridylyltransferase catalyses the interconversion of MgUTP + glucose-1-phosphate and UDP-glucose + MgPPi. UDP-glucose is an important intermediate in mammalian carbohydrate interconversion involved in various metabolic roles depending on tissue type. In Dictyostelium (slime mold) mutants in this enzyme abort the development cycle. Also within the family is UDP-N-acetylglucosamine or AGX1 and two hypothetical proteins from Borrelia burgdorferi the lyme disease spirochaete..
Pfam Number: pfam01704 Score: 1375 E_value: 1e-152
Swissprot: P78811|UGPA1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1066
TTGGCATCATCGCCGGCTCTTTTGAACAATAGCCTCTGCAAGAAGGCCAT
TGAATCAACCACCTTCCATCCATCTTCTATTCCATTGTCCAAGAACGCAC
ATTCCAAGCACGTACAGCAGAAGCCAAAGCAGCAGAAGCCAGTACAGCGG
AAGCCAGTTCAGCAAAATCCGGTTCAACCAGTACAGCAAGAGCCGGTTGA
CGTCAAGCCTGTTGAAGCCAAGCCCATACAAACAGTACAAACGGTCCAGA
CGGTTCAGACAGCCACAGCTATACCAACAGAGCAACAGCAACCCGAGAAA
ATGTCGTCCTTCAAGAAGAGTTTGCCAGTTGAAGGTGGTGCTCCTGGTGA
GGGTCTCGCCCCCCCCGGGAGAAGACATGGAAAGTCCCAGTCAGCTTTCG
CATTTGACAACACCTCAACCTCAGTTGCTGCCAGTCAAATGAGGAATGCT
TTGAACGGCCTTGCCGATAGCGTCAAAGATCCCAAGACCAAAGTGGCTTT
TGAGACTGAAATGGATAACTTCTTTGCTTTGTTCAGAAGATATCTGCAAG
ATAAGGCCAAGGGCACTACATTGGATTGGGACCGCATCCAGCCCCCCCAG
TCTTCCCAGGTTATTCCCTATGATACCCTTCCCAGGGTCGAGGACCCTAA
ACTCCTCTCAAAGCTTGCTGTCCTCAAGCTTAATGGTGGTCTCGGAACTT
CTATGGGATGTGTTGGTCCCAAATCGGTTATTGAAGTCCGTGAGGGCATG
TCTTTCCTCGATTTGTCCGTCCGCCAGGTTGAATATCTTAACCGAACCTA
CAACGTTGATGTCCCATTCGTCCTCATGAACTCGTTCAACACCGACGATG
ATACCCAGAACATCATCAAGAAGTACGAGGGTCACCGCGTAACTATTCAC
ACCTTCAACCAATCACGATACCCCCGCGTCCTTAAGGACTCCCTTCTCCC
AGCCACCAAAGATTACCACTCGCCCATTGTTGACTGGTACCCCCCCGGAC
ATGGTGATGTTTTTGAGTCGCTCCAGAACTCCGGTATCTTGGACAGTCTG
CTCGAGAAGGACATCGAGTATCTCTTCCTTAGTAATGTCGATAACTTGGG
TGCTGTTGTTGACCTGAGTATTCTCGATCACATGAGGGAGACGGGGGCGG
AATACATTATGGAGCTTACCGACAAGACAAAGGCCGACGTCAAGGGAGGT
ACCATCATTGACTATGAGGGAACCGTCCGACTTCTTGAGATTGCCCAAGT
CCCCAAAGAGCATGAACAGGACTTCAAGTCCATCAAGAAGTTCAAGTACT
TCAACACCAACAACATCTGGCTCAACCTCAAGGCTATCAAACGTGTCGTC
GAGAATCACGAACTTGAATTGGAAATTATCCCCAACTCGAAAACCATCCC
CGTCGATAAGAAGGGCGAATCCGACATCTCAGTCATTCAGCTCGAGACTG
CAGTTGGTGCTGCTATTCGTCATTTTAAGAATGCTCATGGGGTCAACGTT
CCTCGTAGGAGATTCTTGCCTGTCAAGACCTGTTCTGACCTCATGCTGGT
CAAGAGTGACCTCTACTCCATGAAACATGGTCAACTTATGATGGACGTCG
CGAGA

Sequences in the Contig:

SY0AAA11YD14FM1 SY0AAA23YO04FM1 SY0AAA38YE09FM1
SY0AAA41YB10FM1 SY0AAA41YL13FM1 SY0AAA49YB06FM1
SY0AAB11YJ24FM1 SY0AAC50YG01FM1