Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1065
Length(NT) : 1013
Best Gene Model Blast : Link to GSTUMT00004378001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001216327.1| Score: 323 E_value: 4e-28
KEGG Definition: hypothetical protein
Accession: ani:AN0186.2 Score: 291 E_value: 1e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1065
TTGGGGCAAGGAGAAAGTTGGCGAGAGGTCTGGCCAGGTGGTTGGACGGA
AGAAGAAGAAGAAGCCGACCTACGGTGTCACTCTCACGATACCTAGTCGT
ACCGGTGGACAGGATCTCGTTCGTAAGGCTCCACGCCAGAGGGTCCACCG
TAAATGCCATCGTTGTCAGACCGACTTTGCCGGGGAGAAGATTTGCAGGA
AGTGCAGCCACACGAGATGCAGGAGCTGCCCACGCGAGCCATTCAAGAAG
AACAAACCGCCCGGATACTATGATTCATTGGACCCCGAAGACAGTGAGGA
GGAAAGGCAGCTTCCTACCCGCCCCCGTCGTACTTACAAGAAGCCCCGCC
GTAGGATTCACTGGATTTGTACGAAGTGTTCTACGACCTTTGTAGAGAGG
ACAAAGATATGTGAAGGATGTGGCAGTAATAGAGATGACACGGGCTTGAG
GGATCCTCCCAAAAAGCAACCTTATAAACCGACAGAGGAAGACATCCAGA
GGCTGGATGAGCGTCTCAAGCAGACGTCTCTTTCAGCCGCTTAATTCTTC
CACATGCTCTTTCATGATGGCTCCTCTTAGGGAGTTTGCAACTTTATCAC
GACTTTCTTTTTTCAACATTATTTTTTCCTGGGGCCAATTGCCGGTCGCG
TACTTGTGTATACTTTGTGGTTTCACTCGGTACGGGCGAGTGGGGCTCTC
AATTCGTCGATACATCACGCTGTCCTGTCAAGTTATTCAAAAACAGGTTC
ATGATGAGCAGTTATGATTGCATTTCGTGCGGGTGGCGGGCGGTTGGTCT
GACATAACCAAAACGGGCATTCTGGAGTTTGCTTTCATTTTCCATTATTC
TTTTAGTTGATGATACCTTGCTGTTTCGTTTTTCTCCCCATTCTTGGGCG
TTGTGTGCATTCTGGAACGACAATGTTTCCTCGCACACGAATTAGTGTTT
TTTTTGTTATTTGATCTTCCAATACCAACCACCATTTTATTGTTAAACCT
ATGTTTTGGAACC

Sequences in the Contig:

SY0AAA31YD19FM1 SY0AAA41YB07FM1 SY0AAA41YG18FM1
SY0AAA46YJ22FM1 SY0AAB26YD24FM1