Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1064
Length(NT) : 2668
Best Gene Model Blast : Link to GSTUMT00004418001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: eukaryotic translation initiation factor subunit eIF-4F, putative
Accession: ref|XP_001260442.1| Score: 1464 E_value: 1e-160
KEGG Definition: eukaryotic translation initiation factor subunit eIF-4F, putative; K03260 translation initiation factor eIF-4F
Accession: afm:AFUA_2G09490 Score: 1461 E_value: 1e-160
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0401 Score: 443 E_value: 4e-44
PFAM Definition: MIF4G, MIF4G domain. MIF4G is named after Middle domain of eukaryotic initiation factor 4G (eIF4G). Also occurs in NMD2p and CBP80. The domain is rich in alpha-helices and may contain multiple alpha-helical repeats. In eIF4G, this domain binds eIF4A, eIF3, RNA and DNA..
Pfam Number: pfam02854 Score: 331 E_value: 4e-31
Swissprot: Q10475|IF4G_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005515 = Molecular function: protein binding
GO:0005198 = Molecular function: structural molecule activity
GO:0006413 = Biological process: translational initiation

Sequence:
>Contig1064
TTGGGGCGGAAGCAAAAGCCGCGGAAGCCTTGAAAGCATCCTCGGCCCCG
ACCATCTCGAAGACTTTCACCCCGGACAACGAAACAATGCCTCCTCCTGC
TAGCAGAGTCGTTGGGGGGAGCAAGCCGAAGCCTAGTCCTTTGAATTTGC
AAATCAAGACAAACGAACCCGGTCCACCCTCCGCTGCCCTCACTTCTTTG
AGATCTGCAAGATTCATCGAGGATATTAACAGCGTAAATTATCCTGCCAA
CATTCTCTCACCCAACCCCGCTCTCAACCCCGCCGCCAGTGGCAAGTTCA
AATATCCTAAGGACTTCTTGATGCAATTCAAGGATGTATTTACCGAGAAA
CCTTCTGTCGATTGGGATCAAAAGATGCGCGAGACCGTCGGCGAACCTGA
CTCCGCACGCCCCCAGACAGCTCGTAACTCGGGCGGCAGCATGGCTCCCC
GTGGCTCTACTCCGAGAACAGCGGCTTCCAGCGCTCAGCCGCCCATGGGT
GCTATGGGCACGTTCGGATCTTTCAAGACTGCGGCGGCTTCTATGATCAC
ATCGAACCGGGGATTCGAGCGCTCTTCCACAACTGGGTCTCTACCTCCAG
GAGGTTTGATTTTCAATCCCCGGTCTGGCGGTGGCGGCGGTGGCGGCGGA
AGTGGTCTCAGGCGCACTGGATCCAGTACCTCATTGTCTGGGGGAAACAC
GCCTGCTAGCCCTCGAACTGGGAACAGATCTTCGCGTGGCAGCAGCAGGA
AAGGTGGTGGTGCTCCGATGGAGAAAACTGAATCCAAGCAAGGATCCGGG
AGTCAGCCGACTATTCCTCTTGCTGAAGTTAAGCCACTGCCAATCTCTGA
GAATAGATGGAAGCCACCGAGTGCAACAAAGGCTGCAGAATCTGCTGCTG
CGTCGACGCCATCTGAGGATAACAGGCTGTCTCCCGAATTGGTCCAACGT
AAGGTCAAGGCGGCGCTGAACAAGATGACTCCCGAGAAGTTTGATAAAAT
CTCAGATCAAATTCTTGAAATCACTAGCCAATCTAAATATGAGACTGATG
GACGAACGCTCAGGCAGGTTATTCAGCTTACTTTTGAGAAGGCTACCGAC
GAGGCGGCTTGGTCTTCTATGTACGCGAAATTTTGCAAGCGAATGCTTGA
GGCCATGGATCCTAGCATCAAGGATGAGAACATCAAGGACAGGAACGACA
ATCTGGTTACCGGTGGAAGTTTGTTCCGCAAGTACCTATTGAACAGATGC
CAGGAGGAGTTTGAACGAGGTTGGAAAGTAAACTTACCTCCCAAACCCGA
GGGTGTCAGTGACGAAGCTGCCATGCTTTCTGATGAGTATTATATCGCAG
CAGCTGCCAAGCGTCGTGGTCTTGGGCTGGTTCAGTTCATTGGAGAGCTT
TTCAAGCTGGGTATGCTTACAGAGCGTATTATGAACGAGTGTGTGCGGAA
GCTGCTTGATTTTGAAGGCGTACCCGAAGATGAAACCGTTGAGAGCCTTG
TTAAGCTTCTCAGAACCATTGGTAGGGCTCTGGATGCTTCTGAGAAGAGC
AAGAATATGATGGACATGTATTTCTCACGGATCAAGCTTCTGATTGGCGA
CAAGGACCTCAACAGTCGGATGCGCTTTATGTTGATGGATGTTATTGATT
TACGCAGCAAAGAATGGGAGACTAAGGAGACCGACAAAGGCCCTAAGACT
ATTCAGGAGGTCCGCGAGGATGCACTCAAGGCACAGCAAGAGAAGGAGGC
TGCGACTCGTGCCAACCAGCGATCGCGCCCCGGTGGTGGGCGTGGCGGAG
ACACCAGATCCTTCTCTGGCGGTGGATATGGCAATATACATCATCAGGGA
GGGTGGCAGGACAACAGCAAGGTTAATACTTCGGATCTCGAGAAACTTAG
CTCGAGGGCAAGACCGAGCAACCGCGGGCCCTCCACCTTTGGGCCTCCTA
GTATGTTTTCACGCAGTACCAGCGGTAGCGGCAGCAGAAGAGGGCTTGGG
CCCTCGATTTCTCGAGGTCCTGAAGATTCACATTCCTCATCCCGCACTGC
TACTCCGGCACCACCCACCTCCTCAAAAAACCCCTTCAGCCCGCTCGGGG
AATCGCACCATGACTCTGGCGAGATCAATGAAGCCACTTCACCACCTTCA
ACTACCTCATCCCCGCCCACTGCCAACTCACGAATCCGTTCACCTCCTTT
GATGAAGGAGGAGGCCAAGTAAATCGATTCGGAGAATTCCTATTCAAAAA
AAAAAAAAAAGTTAGGGTTTGTGTAGGCGTGGGCAAATAGAGAGTTTAGA
ACGGCGTGTATTCTCGGGGTCTTTTTTTTGCTTTTTAAAAATAATGTTGC
CTTGTAAATGCTTATTGGCGATTAGTTTGTGCCTGCTTTTCATTAATTTT
CTCTCCTTTTCTCTTTTTCTCTCTATTTTTTCCTTTTTCATCTTGGTGGG
AAAGAGAAACTGGCCGGCCCTTCACAGCTATTCATTTTTCAGAACTTTTT
TTTCCTCTTTTCTTTCCTCTCTTTAACCGGAAAGGTGCGAATAGGCGGTG
TCACAATTACGAAACGGGTTAAAAGGCGAAAGATGAAAGGAGAAACAGTA
GAAGAAAAAGGTACTCTAATGATAGATAGTCTAACTAGCTACAGTACACA
ATAATGTATCTACTGCGG

Sequences in the Contig:

SY0AAA22YB21RM1 SY0AAA25YL21RM1 SY0AAA39YJ02FM1
SY0AAA3YL04FM1 SY0AAA41YB06FM1 SY0AAB22YC17FM1
SY0AAB51YD05FM1 SY0AAB56YD12FM1 SY0AAB59YH20FM1
SY0AAB6YB15FM1 SY0AAC21YF13FM1 SY0AAC31YD11FM1
SY0AAC3YJ10FM1 SY0AAC47YD08FM1 SY0AAC50YK14FM1
SY0AAD29YL10FM1