Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1063
Length(NT) : 547
Best Gene Model Blast : Link to GSTUMT00007856001 E-value : 1e-154
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 151 E_value: 2e-12
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 151 E_value: 1e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1063
TTGGCCTTCGCCTACCGGTACACAGCGAATTCAAACGAGAGCTATCAGCT
ACAAACTAGAACAGCAAAACCTGTACGCTAGACGAAATGAGCCGAACATT
ATTTCAAAACTCAACCTTGATCGGTAACAACAACCACAACAGTGGGAATA
CCGTAAACAGTTACAACACTATATCCATATCCGATGACAAACGCCAGGTT
CTGGACTGGCTATCTCCATGGACATCACGGGAAAGGCACGGGTCTGTTCG
TAACGCACGGGCGGATGGAGTAGGAGACTGGCTGCTTCACGAAGGAAAGT
TTTCTACATGGCACACATTGGAGAATGCGAAGTCGGTGCTATTATGTTAC
GGAGATCCAGGCGTCGGCAAGACATATATCAGCTCGCTTGTAATAGACAC
ACTTTGCAAAAAGACTTATCCAGAGGCTGGTGACCATCACTTATGTCTAC
TGCGACTTCACAGCTCGCGAGGTTCAATCTGTTAGCAATCTCTTGGGATC
GGTGTTAAGGCAGGTTATAGCAGCAATGACAGAGACCCCCAGTGAAG

Sequences in the Contig:

SY0AAA41YA20FM1 SY0AAA41YG06FM1