Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1061
Length(NT) : 721
Best Gene Model Blast : Link to GSTUMT00004586001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_09117
Accession: ref|XP_001799420.1| Score: 523 E_value: 2e-51
KEGG Definition: transporter, ABC superfamily (Breast cancer resistance protein)
Accession: aor:AO090026000157 Score: 516 E_value: 5e-51
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0061 Score: 505 E_value: 5e-52
PFAM Definition: ABC_tran, ABC transporter. ABC transporters for a large family of proteins responsible for translocation of a variety of compounds across biological membranes. ABC transporters are the largest family of proteins in many completely sequenced bacteria. ABC transporters are composed of two copies of this domain and two copies of a transmembrane domain pfam00664. These four domains may belong to a single polypeptide, or belong in different polypeptide chains..
Pfam Number: pfam00005 Score: 294 E_value: 2e-27
Swissprot: Q9ZU35|WBC7_ARATH

Sequence:
>Contig1061
TTGGATCGAAGTAAGCTAGTTGCCCGGGATTCCGGCTTTCGGTGATTCAT
TCACGCTTGACGCCTCTCTTCTATTTTCATTCGAATCGGATAACCCACTA
CCGGTATACCCTTCTGAAGAAAAGAAGTCACAACAAAAATGAGTGACAAC
ATCGACTTGGAAGCCCTGCCCAAGGGCGGAGGAAAAGAGATTTCCCAGTT
CTCTTGGAAGGGGCTCACTGTCACGGTTAAAGACTCAAAGACAAAGGAGG
CGTTGGATATTTTGAAGGATGTTGAAGGGTGCGCCCAGCCAGGCGACATG
GTTGCCCTCATGGGCCCCAGTGGATCCGGGAAGACCACCCTCCTAAATGT
CCTTGCAAGAAGACCCGTTGCAGCGAGTGCCTCCGTGAAGGGCCAAGTCC
ACCTCGACAATGCTCCGCTCCAAGCAAAAGCTCTTCGGGAGATTAGTACT
TATGTTGAGCAAGAAGATGCGCTCATCGGTAGCTTAACTGTCCAAGAAAC
CATCGAATTTGCCGCCCGCCTCTCGGGAGCCGAACGCCATGCTGGCCGTG
TATCGGAGTTGATCAGAGCATTTGGATTGGCGAAGCAAGCGCATACAAAG
ATCGGTACCCCCGTCGCCAAGGGTATCTCCGGTGGGCAGAAGAGGAGGGT
TAGTATCGCTTCGCAGTTGATCACTCGACCGAAGATTTTGTTCTTGGATG
AGCCGACTAGTGGATTAGACT

Sequences in the Contig:

SY0AAA34YD22FM1 SY0AAA40YP13FM1 SY0AAB25YI09FM1