Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1060
Length(NT) : 1438
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 1e-163
Numbers of ESTs : 9

Blast Results:

Nr Definition: heat shock protein 82
Accession: ref|XP_001216617.1| Score: 594 E_value: 8e-84
KEGG Definition: molecular chaperone (HSP90 family); K04079 molecular chaperone HtpG
Accession: aor:AO090102000620 Score: 599 E_value: 7e-84
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 587 E_value: 4e-61
PFAM Definition: HSP90, Hsp90 protein..
Pfam Number: pfam00183 Score: 784 E_value: 6e-84
Swissprot: P40292|HSP90_ASPFU

Sequence:
>Contig1060
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGTCTAGAGAAACACTCTCG
ACTTTTCTCAGAGCCCAATCAATTTCTCCTGCATCTCCTCATTCACCTCT
CTATTTCCCTGCACCTTTAGAGATTCATAGACCCGAGAAGATAGCAAACA
ACCATTGCCATGGCTGAAACCTTCGAATTCCAAGCTGAGATCTCTCAGTT
GCTCTCCCTCATCATTAATACTGTATACTCGAATAAGGAGATTTTCCTTC
GAGAATTGATCTCCAATGCCTCAGACGCTTTGGACAAGATTCGCTACATT
TCTCTTTCCGACGCTAGCGTCTTGGAAGAGGAGAAGGATCTGAAAATTCA
CATTATCCCTAACAAGGAGGCCAAGACTCTTTCAATTTTTGATACTGGTA
TCGGCTTTACTAAATCTGATTTGGTAAACAATCTTGGTACCATTGCCCGA
TCTGGTACAAAGCAGTTCATGGAGGCCCTGTCCGCAGGTGCTGATATCTC
GATGATTGGTCAATTTGGTGTTGGTTTCTACTCGGCATATCTTGTTGCCG
ATAAGGTTGAGGTTGTTACCAAGTCGAACGAAGATGGTTAGCTTCTCCCT
TGACGCTTGACTGTTGCTGGCCTTTTTTAGCTAACCCAATCTTAGAACAA
TACATCTGGGAGTCGGCTGCTGGTGGTTCTTTTACTATCAAATTGGATGA
GACCGGAGAAAGAATCAAGCGTGGTACCAAGATTGTCCTTCATATCAAGG
ATGGTCTGCAAGAGTATCTCGAGGAGTCTAAGATTAAGGAGATCGTGAAG
AAGCACTCCGAGTTCATTTCATACCCTATTTTCCTCCACGTCACCAAAGA
GGTTGAGAGAGAAGTTCCTGACGAGGATGAGGAGGAAGAGAAGACAGAAG
AGGGTGATGATAAGAAGCCCAAGATTGAAGAGGTTTGTTTGATTTTTTCG
TGTTATTTTTTACATATCTAACATTTGCGCAGGTCGATGAAGAAGAGGAA
AAGAAGGAGAAGAAGACCAAGAAGGTGAAGGAGACCAAGGAAGAGGAAGA
GGAGCTGAACAAGACAAAGCCCATCTGGACTCGTAACCCCTCCGACATCA
CTACTGAGGAGTATGCCAGCTTCTACAAGTCTCTATCCAACGACTGGGAA
GATCACCTTGCTGTCAAGCATTTCTCGGTTGAGGGCCAACTTGAGTTCCG
CGCCATCCTTTTTGTCCCCAAGCGTGCTCCCTTCGACTTGTTCGAGACCA
AGCGCTCCAAAAACAACATTAAGCTCTACGTCCGCCGTGTATTCATTACT
GACGACTGTACTGATTTGATTCCGGAATGGCTTGGTTTCATCAAGGGGGT
TGTCGATTCTGAGGATCTCCCACTTAACTTGTCTCGTGAGACTCTCCAAC
AGAACAAGATCTTGAAAGTTATCAAGAAAAACATTGTC

Sequences in the Contig:

SY0AAA21YL03FM1 SY0AAA24YM05FM1 SY0AAA40YO13FM1
SY0AAA57YJ01FM1 SY0AAA60YF03FM1 SY0AAA7YF21FM1
SY0AAB22YE11FM1 SY0AAB35YO11FM1 SY0AAB41YO20FM1