Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig106
Length(NT) : 851
Best Gene Model Blast : Link to GSTUMT00009705001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_07334
Accession: ref|XP_001591888.1| Score: 782 E_value: 2e-81
KEGG Definition: hypothetical protein
Accession: fgr:FG06659.1 Score: 759 E_value: 4e-79
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport, Translation, ribosomal structure and biogenesis].
Kog Number: KOG2021 Score: 471 E_value: 6e-48
PFAM Definition: No Hit Found
Swissprot: O43592|XPOT_HUMAN
Gene Ontology:
GO:0000049 = Molecular function: tRNA binding

Sequence:
>Contig106
TTGGGAAGCTGATGAGGCCGAGTTCCAAGCACTCCGAAAACGATTGAAGA
CTTTGCAGGACACTGTTGCCGCCATTGACGAACAACTTTACATCAATACA
TTATCCAGCCTTATCGGTACCACATTTGATAGAGTGGCGGAGGGTGGAGT
TGCTGCTGCTGATTGGCGAGAGGTTGACTTAGCCATGTACGAGATGTTTC
TCTTTGGAGAATTGGCTATGAGGAGCGGTGGCATGTTCAATAAGGGGCGG
CCACAGGGGCTAGCGGCGGAGGCTCTAATCAGCCTAATGATCAAAATGAT
GAATTCTGGTATCGTGGCGTCTTCACATCCGGCTATCAAGCTCCGATATA
TGGAAACAGTTGTTAGATATGCGGCATTCTTTGAAGTTCATACCACTTAT
ATACCAAAAGCTCTGGAGAATTTTGTGGGGGGTGTGCACGACAGCCATGT
GCGCGTCCGAAATAGGTCATGGTACCTCTTTTTTCGATTTGTCAAAACTC
TTCGCCAGCACATCGGTGGGGTTGCCCAAGAGGTGCTGGAGGCAATTAGC
GATATTCTCGTCATAAAGGCTGAATTGCCGCAAGATGCCGGAGACAATGA
GATGTCATCAGACGATGCACAGGGTGAGGATGCTACCTTTGAGAGCCAGC
TGCATCTCTTTGAGGCGGTCGGTTGCCTCTCATCCATAAAATCCGTCGCA
CTTGAGAAACAAGTGCTTTTTGTGACAACAGTCATGACCCCGTTATTTAG
GAACATGGAAAGTACCTTAGAGGCGGCAAAGCAAGGCGATGCCCGGTGTG
TGTTGCAAGTTCATCACATCATGATGGCTTTAGGTATCCTGGCTAAGGGC
T

Sequences in the Contig:

SY0AAA14YC16FM1 SY0AAB1YI23FM1 SY0AAD51YO16FM1