Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1059
Length(NT) : 1064
Best Gene Model Blast : Link to GSTUMT00004877001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_04214
Accession: ref|XP_001594407.1| Score: 877 E_value: 3e-92
KEGG Definition: carbamoyl-phosphate synthase, small subunit [EC:6.3.5.5]; K01956 carbamoyl-phosphate synthase small chain
Accession: afm:AFUA_5G06780 Score: 783 E_value: 1e-81
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0370 Score: 588 E_value: 2e-61
PFAM Definition: CPSase_sm_chain, Carbamoyl-phosphate synthase small chain, CPSase domain. The carbamoyl-phosphate synthase domain is in the amino terminus of protein. Carbamoyl-phosphate synthase catalyses the ATP-dependent synthesis of carbamyl-phosphate from glutamine or ammonia and bicarbonate. This important enzyme initiates both the urea cycle and the biosynthesis of arginine and/or pyrimidines. The carbamoyl-phosphate synthase (CPS) enzyme in prokaryotes is a heterodimer of a small and large chain. The small chain promotes the hydrolysis of glutamine to ammonia, which is used by the large chain to synthesise carbamoyl phosphate. See pfam00289. The small chain has a GATase domain in the carboxyl terminus. See pfam00117..
Pfam Number: pfam00988 Score: 505 E_value: 8e-52
Swissprot: Q0U5H7|CARA_PHANO
Gene Ontology:
GO:0004088 = Molecular function: carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity

Sequence:
>Contig1059
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAAACGGCAAGATCGTTTTG
GTCACTTCATTAACCTCTTTTTTCAATAAACACCCTTTTCAAACTTTAGG
CCTTGACAATTCCCTTTTTATCGAAAGGGACTTCTCGCTTGTCGGAGGCA
TTGAAAGGTTGCCCGTATGCGATTGTTTCCTTCCGAATTCACTTCACAGG
ACTACATCTCAGGTACGCAGCGTGCTTGTCGACCCCAAATCCGATCCGGG
GATGGAGGGAAGAGGGCTTACACTGCTGAGAGCTGATACTAATATCGGTG
GTAGATCACGTCTGGAAAAATTCATCATTCTAAACCGGTATCCTCCGCCA
TTGGATATCAAAAAATCAATTGCAAAAATCAATTACATTTATACCCTACC
CGGACATCAATCTTTTCCAGACGATGTTTGCTCGCCAGATCTTGGCAAAG
GGCTTCAAGCCTTCTGCTGCGGCTGCCCGCCTTAGCTTCAGAAATGTGAG
GGGTTTAGCTACCATCACCGGTAGTACTGGTAGACAAATGCCGCAGCCCA
CAAGGGAAAGGAGCACTCCAGTCAGTCATGATCGCGCAACCTTCACTATT
AGGAACGGTCCTATCTTTCATGGCAAGTCGTTCGGAGCTCGTTCCAACAT
TTCCGGAGAAGCTGTTTTCTCCACCGCCCTAGTCGGATATCCCGAATCCA
TGACAGACCCATCCTACCGTGGGCAGATTCTCGTCTTCACTCAGCCGCTT
ATCGGAAATTATGGCGTCCCCTCTGCTGATAGGGATGAGCACGGGTTATT
GAAGTATTTTGAATCTCCCAACATTCAGGCTATCGGAATTGTGGTTGCCG
ATGCCGCGCTCAAGTACTCGCATTGGACTGCTGTTGAGTCGTTGGGTGAT
TGGTGTGCCCGTGAGGGTGTTCCCGCCATCACCGGTGTTGACACCAGAGC
GATTGTTACCTACCTCCGAGAGCAGGGTTCCTCGTTGGCTAGGATCACCA
TTGGCGAGGAGTACGACGCTGACCAGGACGAGGCTTTTACCGATCCTGAA
CAGATCAATTTGGT

Sequences in the Contig:

SY0AAA40YM15FM1 SY0AAC19YI13FM1 SY0AAD26YK03FM1
SY0AAD2YO16FM1 SY0AAD60YJ02FM1