Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1057
Length(NT) : 1255
Best Gene Model Blast : Link to GSTUMT00012172001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU10006
Accession: ref|XP_959452.2| Score: 341 E_value: 5e-30
KEGG Definition: hypothetical protein
Accession: ncr:NCU10006.1 Score: 341 E_value: 2e-30
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3623 Score: 210 E_value: 2e-17
PFAM Definition: Glutenin_hmw, High molecular weight glutenin subunit. Members of this family include high molecular weight subunits of glutenin. This group of gluten proteins is thought to be largely responsible for the elastic properties of gluten, and hence, doughs. Indeed, glutenin high molecular weight subunits are classified as elastomeric proteins, because the glutenin network can withstand significant deformations without breaking, and return to the original conformation when the stress is removed. Elastomeric proteins differ considerably in amino acid sequence, but they are all polymers whose subunits consist of elastomeric domains, composed of repeated motifs, and non-elastic domains that mediate cross-linking between the subunits. The elastomeric domain motifs are all rich in glycine residues in addition to other hydrophobic residues. High molecular weight glutenin subunits have an extensive central elastomeric domain, flanked by two terminal non-elastic domains that form disulphide cross-links. The central elastomeric domain is characterised by the following three repeated motifs: PGQGQQ, GYYPTS[P/L]QQ, GQQ. It possesses overlapping beta-turns within and between the repeated motifs, and assumes a regular helical secondary structure with a diameter of approx. 1.9 nm and a pitch of approx. 1.5 nm..
Pfam Number: pfam03157 Score: 122 E_value: 3e-07
Swissprot: O95365|ZBT7A_HUMAN
Gene Ontology:
GO:0003677 = Molecular function: DNA binding
GO:0035035 = Molecular function: histone acetyltransferase binding
GO:0016564 = Molecular function: transcription repressor activity
GO:0045892 = Biological process: negative regulation of transcription, DNA-dependent

Sequence:
>Contig1057
TTGGGGACCCAACGAGATAACCAGTCCATTGAGCAGTGGTGGTAGTAGTG
CTGGAACGGTATCTGCCATGGGACAGTTTTCCCCGGTTGGTTATTGGCCT
GCTACCTCGAATAGTTCGCCCTATGGTTACGGCTCAGCCTCAGCAAATGC
TTCGTATACGTCAGGAGGGATCCAGAGTTCCACAAACTCAAACTTTGGGG
TTAGAGGGTTTACCTCGCCTGGCGTAACGTTGAACAGAGGAAACAGCAGA
CCCTCAAGCCCTGCCACTGGGGAGTTAGTTCACCCCCCCAGTTTTGACAA
TCCGTCGCCCTATACAGGCGGGATACCCATCTCGACCAGTGCTGGGGGCC
ACCCAATCGCTGCGGTAGCTGGATCAGGTTTACCTTCGATAGGGCCGGGG
TCGAATGTCCATGGTAACTACGCTGCTGCCTACCTTCAACCCAATCAGCA
CCCTAACCAGCCCCACCCTCCAATGAACAGCCAATCACAACAAAATCACG
ATCCGTATTCCCCTCAAGGTTCGTTACCTCCTCCAAACCCCTCGCAGCCC
TATTATGGACAGCAGCAACAACAAGGCCTTCAAATGTCGCCCTCGAGTGT
TATGGGTAGACAGATGAACTCTGGGCCCCAGTACCCGCCACTAGTCCCGT
TGCAACCGAATTACAAGCCTCAGTACCCTCTTCCGGGGGTAGGCGGACCA
GTTATGGGTGGGATCTTACACGGACACCCAGGCATGATGACCCATCACCA
TCCCGGTGCTCACCATCAACAGCAACAAACCGAGCGACCCTTCAAGTGTG
ACCAGTGCCCTCAAAGCTTCAACAGAAACCACGACCTGAAGCGACACAAG
AGGATACATCTGGCTGTTAAGCCCTTCCCTTGCAATAACTGCGAGAAGAG
CTTCAGTAGGAAGGACGCTCTAAAGAGGCATCGCCTTGTTAAGGGATGCG
GAAAGAACGACCATCTTCAAGGACAACCTTCGCCTGCTACTACTGGACAG
GATTCGAAACAATCACCTAGCGTCTCACCGGTTAGTGCTAGAAATCCTGG
CCCGGAACGAAACGCCAGTCCACCAGGGAGCGCTGGTGGTATGATAAAGC
ATGACCGATAATATAGTACCTTGACAGCTTGTCATCTATCTCTCGGCTCT
TCGAGACTTGTAAGCTATAATATTTTCTTGGTGGATACCCTCGATACCTT
TCGTCTATTGTCGTTATAAAGACCTTATTCTTTCGGTTCTCTTACCACAT
GTCCA

Sequences in the Contig:

SY0AAA16YD08FM1 SY0AAA18YL05FM1 SY0AAA40YL21FM1