Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1055
Length(NT) : 676
Best Gene Model Blast : Link to GSTUMT00007631001 E-value : 1e-130
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1055
TTGGCTCAGCGCAGGGATGTGGCAAAGGTGGTCGCTCTCGGATGCTTGTC
GAGTAGGAACTTCAAACGTTCCGCTCACGAATGGTGACACTTTCCGACTA
GTTTTGTGCCCCTCCTTCCCTCATCCAACAACCCAGTTCAAACCCCTCCA
ACCGCCGTCGTCGGACAAGGGCGAAGCCGGGCGCCTCCAATCAACGTAAT
AATCCCACGATTTCTCTCCTCCCTCCCTCCCCCTCCCCCTTCCCTCCTTC
TCTTACTACCCCATCTTCTCGGTTCGGCCTTAGCTTCGTTCAACACAAAG
AACTCCTCCCTCTCCCCCCCCCCTCCGTCGACAAACCAAGCTTGCCTCCT
AATACCTATTTTGCACTCTTATTTGCCTTTTATTAGTTGGTCGAAGCACC
TTTGCAACCAGAACCCCACTTTTTGCGAAAAGAAAAGGAGAGGATGGCTA
CTACCGCTACCAGCTCGACGACACCTACTTCTTCCCCTTCCGCCTCTTCT
CTCCCCGCTCTTACTGTTAATGGCTCCTCGCCGACTACTGGGCCCGGGGA
TACCGGTGGAATAAGAGCGGAACTCCGAAAGAACATGTTGAAGAAACTCA
GGCCGTACCCGTTGAGGCATGAATGGGTCTTTTGGCACGATAGGAACTCA
AATACGAACGAGGAGGAGTGGGAAGA

Sequences in the Contig:

SY0AAA11YI14FM1 SY0AAA40YL05FM1 SY0AAA40YM05FM1
SY0AAB49YB11FM1 SY0AAD1YD23FM1 SY0AAD23YI16FM1