Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1054
Length(NT) : 841
Best Gene Model Blast : Link to GSTUMT00007400001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: DUF566, Family of unknown function (DUF566). Family of related proteins that is plant specific..
Pfam Number: pfam04484 Score: 112 E_value: 3e-06

Sequence:
>Contig1054
TTGGTAAAAATGAGGGGAGAACATCGAGAATCCGCCCCGACAATCCCTCA
ATCCGGGGCTGAAGCTCAAGGTGGCTCTTCCCTGCGAGTGGTTAGGAAGA
AGGGCAGCTTGAGATCGATGTTTGGTTCATTCTTGAAGTCAGCAAAGGGT
AGGAGAGCCAATAAGACTGCGTCCCAGTATCCAAGTCGGGGGGGTGAGGC
TGGTGCCAAGAATAGAGGGAATGAGGCACCCACACTCTCTGCCATTTCTC
TCCCAACTCAGGCTCGATCATCGACATCGTCTACCTCCTCGCCATACGAA
GATGATGGGGAATTTAGCAACATCGTTCCATATAAGGAACATGGAGCATC
GTGTAAAACATGCTCCGCAACTTCATTGCCAGCTCAAATCCGCCCTCCGT
TTGCATTCCATGCGCCTTCCTCCTCCTCTTCGTCTACCTCATCGATTGAG
TTTGCTTCAGATGCATCTACAGCAGCAACTTCCCCCTCGGTGTCGTCTCC
CTCTGTCTTGATTAAATCGCCATCTTCACAGTCGATTTCAGCCCTAAATC
ACTCGACAACTTCTCTATCCAGCACTCCCTCGAGGGAGACTAGTCCTACC
AGGGCTCAATCTTCGGCGAAATCATCTATGATGTCTAAGCGAGCACTGGA
AAACCACAGCAAACAACCCTCACCATTGTCAACTGTTACAGATGCTCATT
CGCCTTACATACTTCCAACAACCCCAGAATCTCCTGTGCTGCACGAAAGG
CCCAATAGTTTCCAGCCCAAGCGCAGGGGCTCGTTGAGCAACTTCATTTT
ACGTCGAACACAGTCACACCCCGACCTGACAGACTTCACAA

Sequences in the Contig:

SY0AAA40YK11FM1 SY0AAA58YI06FM1