Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1053
Length(NT) : 1136
Best Gene Model Blast : Link to GSTUMT00005701001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein AN4082.2
Accession: ref|XP_661686.1| Score: 292 E_value: 2e-24
KEGG Definition: hypothetical protein
Accession: ani:AN4082.2 Score: 292 E_value: 1e-24
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG3655 Score: 114 E_value: 2e-06
PFAM Definition: Protamine_P1, Protamine P1..
Pfam Number: pfam00260 Score: 112 E_value: 4e-06

Sequence:
>Contig1053
TTGGGATCATCTGGCACTCAACACCAATCACGGGCATCTGAGAAGGCCCC
TGCACGTGAAAACACTGACAAACTCGCCCCGGAACCCCAGAAGCTGCCAT
TCCACGGGGTATTCCCTGATGTTGTTGATACTCCCCAGGGACCCGTCGAC
CAAACCCAATTCTTTCAAACTGGCCCAGCCACTTATCAGGTTTCTGATGT
TCCAGCTAGACGTTCTGCTCCTCCACCTTCCTCCCCCCCACGTCAACAGG
AGCAACAGGCACCGCTGGTGACACCATTCTCTACACCATATTACAACTGG
GATCCTACTCGCTCGGCTCCACCAGTCGATAGTGCTCCGGAAGCCAATCG
TTTCCCCCGTCAGTTCTACTCCAATGAATGGGATAACCCTGCGCCGGCAT
TTAAGACTCCAGTGCCTGCCCCCCCACAGGGACAGAAGAGATGGTTTGAG
AGCCGTGAGAAGACCCCGGAGCCTCAGCGGGAGCCTCCGCTAAGACAAAT
TTTCCCATGGGAGAATAAACCAAGGACCACTACTCGCGTATTCGCTGATG
ACCCGCCGGTCGAGGAACATGTTGAGGAGCCGGAAGAGGAAGAGGAGGAG
GAGGAGGAGGAGGAGGAGGAGGTCCAACAGGAGCAGGAACCCCAAATTAC
TAAGGAGGAGGCCACGGCTTGGAGAACATATGTCCAGGAGAATGAGTGGG
ATGCGATTCCAGGAATCCAAGACTACGTCTCGGATTTAAAGCGCCGTGGC
AATCACGTACTCCAGTCTCTCGAAGCCAGTCCCCGCATTCCGGGATACTT
CATCCCCCTTGTTAGTCAGGAGAGGCCATCTTTGCCCGTGACCCCGAATC
CCGTCAAAAGAAGAACTGCACAATGGACTGCTGAGGAACAACCCCAATTC
CCAAGTGCTCGTGGGATCCCCTCTCAGGAGGACTGGGACCCTCATGCAAA
GCTCGATGAACTTAGACGCCTCCCACCCTCTTTCGTCTCAACCCTCAGTA
ACACCAATGTGATCGGTGGTGCTGCCCAGACCGAAGCCCAGAAGGAAGCC
ATTGTTCCCGAGGCACCGTTGGAGGTTCAAGCACAAGCGGACGTTACTGT
CTCACCTCCTTCCCCAGCCTACAGAACCAGCGCAGC

Sequences in the Contig:

SY0AAA24YL08FM1 SY0AAA24YL08FM2 SY0AAA40YK09FM1
SY0AAA59YH10FM1 SY0AAB59YP05FM1 SY0AAC44YK01FM1