Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1052
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00006629001 E-value : 2e-98
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1052
TTGGGTGGCTCCTCAGCTTGCTAATGGCTCGAGAAATGGGTGCGGCTTCC
ACCCAACGCCCCTTCGAGATCTTTGGTCCGCTCCAGTCGGATACATATGG
CTTGATTTCTTCCTCACAGCGAGAATAAGCTATATTTTTGGGCGCCTCGC
CAAAACGCTCCGGCCAACCGTGCCCCGACTATAACTCCTCATTTCTCTAT
TCTAACTGGTTCAACCTCGGAAGGGTTTACCCTCCGCGTCTACCGCGCCC
GGAACTCTCATCAAGGAAAGTTAGGGTAATATATCCCTCCGAGAGACCAG
GGAGTCAAACAATCTGTGTCCCATCGCAAGAATACGGGGGTACATTAACG
GTATCAAACCTGGATTTCGCTAGATTATCCCCGGGGGTGATCGAACACAC
TTGCAGGGGAGATGTGTCGCATAACCTCCGGTTACTCGAGTAGTCTACAG
TACAGGTGTTTTGGGCAAGTTCTATCATAGCCAAATTGCGGTATCATACC
ATTGTCCTGGCGTGATCGGAGGTAACACCGAGGACTTATCATACTTTGTA
TAATAGTTGCTTAGATAAGCTACGAGCAGTCCCTTGTGCCACATAGCACA
CCAACGC

Sequences in the Contig:

SY0AAA40YJ23FM1 SY0AAB36YE16FM1