Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1051
Length(NT) : 2013
Best Gene Model Blast : Link to GSTUMT00008516001 E-value : 0.0
Numbers of ESTs : 36

Blast Results:

Nr Definition: hypothetical protein SNOG_01992
Accession: ref|XP_001792613.1| Score: 521 E_value: 1e-50
KEGG Definition: predicted protein
Accession: aor:AO090005001138 Score: 497 E_value: 3e-48
KOG Definition:
Classification: [Amino acid transport and metabolism, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1046 Score: 365 E_value: 3e-35
PFAM Definition: Peptidase_M1, Peptidase family M1. Members of this family are aminopeptidases. The members differ widely in specificity, hydrolysing acidic, basic or neutral N-terminal residues. This family includes leukotriene-A4 hydrolase, this enzyme also has an aminopeptidase activity..
Pfam Number: pfam01433 Score: 344 E_value: 8e-33
Swissprot: P55786|PSA_HUMAN
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0004177 = Molecular function: aminopeptidase activity
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1051
TAGAGCAGTGAAGTTTTCTGGAACTGTGATGGAGAAATCATAGGTAGCTT
TAAGGTTTGGTTCATCGAAGCAAGGGAAAGCTCTCCGAGCATCACAAGAC
TCAAATTGAGTGGAAAACATCCAGTCGTCTTTTCCTTCGACATTTTTGTA
TGCACTTCGATAGAAGCCGGCCATCTCATGGTTAATAGACCCTGAGAAAT
TTATTTCTAGAACGCCCATTCCGCTTCCCGGGGTTGGTCTCTCAAGAGAA
AGCTTCGCTACTTCGGCCTTCTTGTCACATTCGATCTTGGAGATGTTGAT
ATCACTGTCTGAGCCATCGACAATAAGACGCCCTCCATGGAGTAGTAATT
CCTTGCAGTTGAGGAAAATAGAACTAGCTTGTTGTTTGAACTCGAGTGAA
ATACTGACCTGGCCATCGTACGTGAAGGCACTAAGGTCAAGTTTAATCAA
GTCCAGGTCATAGTGGACAGGGATGACATCAGATGGTAAAGTCTCGCGAT
CAGCCGTGGATGTCATTACTGTGCGCTGGTATTGGGGGGACAACTTTGTA
CAAAAAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGCATTAACATCA
TATCCGCTCACATGGACTACTTGAAAAAAAAGTTGAATCGTCGCAACCAA
CAAGGACAACCACCCGCTTTCAGGAGCTTCGTGGATGATGGGAAGTTTGA
CCCATTCGGAGACTTTAGTGTACAGTTCCCATCTGCTGGATTATCTGCTC
CCACACGAAAACCCCCACCATCAAACGATTCGAGCATCGCTCCACCACCG
ACCTACGATGAATCCGCACTAACAGCCCCAGAACCTGCCGTCAGGCGTGG
GACCTTCTCCGATACCTCACCAACCGCCCAACAATACGCGGGGCTCAAGA
AATTCGACACGGTCTTCCTCATAGACGACAGCGGTTCTATGGTTGGTTCA
AATTGGCGGCAAACCTCGTCGGCGTTAGCCGCTATTGTGCCGATCTGTAC
GGCACAAGACTCAGACGGTGTGGACATCCACTTCCTAAATCACGACAGGT
CGCACACGAATGTGCGTAGCGCAGATCAATTGCAGCGCATCTTCGCCTCC
GTAACCCCGCGGGGGATCACACCTACCGGGCGGAGGCTCGGCTTCATACT
GGACGAATACTTGATGCGATACAAAAGGAATAGAAATATCAAGCCACTCA
ACGTCATCGTTATCACCGACGGAGAACCTACGGATCCGGACAGGCTTGAG
AAGAACATTGTCAAGTGCGCGAGGGAACTAGACAATGTGGGCGCAAAGGA
CCGGCAGGTCGGCGTTCAGTTTTTTCAGGTGGGGAACGACGAAGCGGCCA
CCGAGAGTTTGGATGAGCTTGACAATGCACTTGTGGAGGAGCACAGCGTT
CGCGATATGGTTGATACCGTTAGCTGGAAAAAGATGAATGAGGGGAATGG
GCTTACGGCTGATGGCATCCTGAAAGTTGTCATGGGTGCTGTTGATAAGC
GCCTGGATAGAAAGCGGCGCTAGTTGACTCATTGTTTTGTTTTTTTGCTT
TTTATTTTTGCCCAATGTCTTTTATTGATTCTACCACATTGGCTGGCGAC
ACTGGGGATGGAGCGGAATCGGGCGAAGTGTGGTCTGATACGTGGGCCAA
GTTCTTTTAGGGGGCATATACCTCAGCAGAGACAGTGCCCCGTGGCAGGC
TGTGAGAACCTGACCCTAGGAAGCGACTTCTTCTGGATCTAGTTCGCCTT
TTGGGCCACATCCTCTGCGCCATTTCCGGTATCTAGGTCCATCGCTTTCT
TATTTTATTTCTTTCTTTTATCACTATTTCTTTTGGTGGTGCTCCTAGGG
ATATCAGGATAATAAGCTCAGCGACCGTGGTACGCTCGCCAAAGTACGAG
AACCACTGGCGCAAGGGCTGGGACTTTGTTTAGCTTCTTCTCGTTAAATT
TCCTAACCTTACTTAACTGGTGGACGACGTTGAAACCGAAACTGCTCAAT
TTCGTTCCTGGTT

Sequences in the Contig:

SY0AAA15YF17FM1 SY0AAA22YN16FM1 SY0AAA27YM22FM1
SY0AAA34YM18FM1 SY0AAA36YH20FM1 SY0AAA38YO10FM1
SY0AAA40YJ10FM1 SY0AAA56YD14FM1 SY0AAA63YJ07FM1
SY0AAA63YK12FM1 SY0AAA6YE08FM1 SY0AAB14YC15FM1
SY0AAB16YA06FM1 SY0AAB20YD17FM1 SY0AAB23YL09FM1
SY0AAB24YH11FM1 SY0AAB24YK13FM1 SY0AAB27YC02FM1
SY0AAB29YC20FM1 SY0AAB42YB19FM1 SY0AAB45YK22FM1
SY0AAB49YA05FM1 SY0AAB51YA09FM1 SY0AAB60YA03FM1
SY0AAB60YN17FM1 SY0AAB60YN22FM1 SY0AAC16YO17FM1
SY0AAC36YN07FM1 SY0AAC40YM11FM1 SY0AAC44YJ14FM1
SY0AAC45YC04FM1 SY0AAC9YO21FM1 SY0AAD10YD03FM1
SY0AAD17YG06FM1 SY0AAD20YB02FM1 SY0AAD25YJ21FM1