Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig105
Length(NT) : 2477
Best Gene Model Blast : Link to GSTUMT00010477001 E-value : 0.0
Numbers of ESTs : 69

Blast Results:

Nr Definition: dnaK-type molecular chaperone bipA-Aspergillus niger sp|P59769|GRP78_ASPAW 78 kDa glucose-regulated protein homolog precursor (GRP 78) (Immunoglobulin heavy chain-binding protein homolog) (BiP) sp|P83616|GRP78_ASPNG 78 kDa glucose-regulated protein homolo
Accession: ref|XP_001394413.1| Score: 2638 E_value: 0.0
KEGG Definition: bipA; dnaK-type molecular chaperone bipA-Aspergillus niger
Accession: ang:An11g04180 Score: 2638 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0100 Score: 2819 E_value: 0.0
PFAM Definition: HSP70, Hsp70 protein. Hsp70 chaperones help to fold many proteins. Hsp70 assisted folding involves repeated cycles of substrate binding and release. Hsp70 activity is ATP dependent. Hsp70 proteins are made up of two regions: the amino terminus is the ATPase domain and the carboxyl terminus is the substrate binding region..
Pfam Number: pfam00012 Score: 2385 E_value: 0.0
Swissprot: P83616|GRP78_ASPNG
Gene Ontology:
GO:0005788 = Cellular component: endoplasmic reticulum lumen
GO:0006986 = Biological process: response to unfolded protein
GO:0045045 = Biological process: secretory pathway

Sequence:
>Contig105
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTTTTTCCCGGGGGCTCGA
CATTATAAAGATTTCTTCTTCTCTCTCTCGCGTCAACCAGCTTCCCTTCC
CTCTTCCTCCCTTCTTCTTCCCCACACAAAACTCGAAAACCCGTTTCTTC
GCTCATTCATTTTTTTCTCTCACCCACTTTCCCCTCTCCTCTTTCCCTTT
ACCGAAAATCTGTAGACTGGTACTCTCAGAAACAATCATCCGCCAACTGC
TACGACCTTTAAGCTTTTTCATCTTTTATCCAAAGGCTGCCCCTGATGTT
TGAATCCAAGGGCAAGGGGGTCACTTGGACCACTATACTTTACTTATTTT
GCATTTTCCTAGCACCTCTCCTGTTTCTCTCTCCAGCAACCGCTGCGGAG
AACGAGACTGACAACTTCGGAACTGTTATCGGTATTGATTTGGGAACTAC
CTACTCATGTGTTGGTGTTATGAAGGGTGGTCGTGTCGAAATCTTGGTCA
ATGATCAGGGAAATCGTATTACTCCTTCCTATGTCGCTTTCACGCCTGAT
GAACGTCTTGTCGGTGATGCCGCGAAGAATCAATATGCCTCTAATCCCCA
AAACACCATCTTTGACATCAAGCGTCTCATCGGACGTAAGTTCAACGAGA
GGGATGTACAGAATGACATGAAGCACTTTCCCTTCAAGGTCATCAACAAG
AATGGTCAGCCCGCTGTCCAGGTCGAGGTTGGTGGTGAGGAGAGGGATTT
CACTCCCGAGGAGATCTCCGCCATGGTTTTGGGCAAGATGAAGGAGATTG
CCGAAGGCTACTTGAGCCAGAAGGTTACACACGCCGTAGTCACTGTCCCC
GCCTACTTCAATGACGCACAGCGTCAAGCTACCAAGGATGCTGGTGTCAT
TGCCGGTCTCAATGTTCTTCGTATTGTTAATGAGCCCACCGCCGCCGCCA
TCGCCTATGGATTGGACAAGAAGGACGGTGAGCGTCAAATCATTGTCTAC
GATCTTGGTGGTGGTACTTTCGATGTTTCTCTCCTGTCTATCGACCAGGG
CGTTTTCGAGGTCTTGTCCACCGCTGGTGATACTCATCTTGGAGGAGAAG
ATTTTGATTACCGTGTCATTACCCATTTCGCCAAGCTCTACAACAAGAAG
AACAACGTTGACATCACCAAGGACTTGAAGACCATGGGTAAGCTGAAGCG
TGAAGTTGAAAAGGCAAAGCGCACTCTTTCTTCCCAGATGTCTGTCCGTA
TCGAAATCGAGGCCTTCCACGATGGTAAAGACTTTTCCGAGACTCTTACC
CGGGCCAAGTTCGAGGAGCTCAACCTTGACTTGTTCAAGAAGACCCTCAA
GCCAGTCGAGCAGGTTCTTAAGGATGCCAAGGTCAAAAAGTCTGAGGTTG
ACGATATCGTTCTCGTTGGCGGTTCCACTCGTATCCCTAAGGTTCAGGCT
CTTCTAGAGGAGTTCTTTGGTGGTAAGCAGGCTTCCAAGGGTATCAATCC
TGATGAGGCTGTTGCCTATGGCGCCGCTGTCCAGGGTGGTGTCCTATCTG
GTGAGGAGGGCACTGAGGATGTCGTTCTCATGGACGTCAACCCATTGACT
CTCGGTATCGAGACCACCGGTGGTGTCATGACTAAGCTTATTCCCCGCAA
CACTGTTATCCCTACCCGCAAGGCTCAGATATTCTCCACTGCTGCCGACA
ACCAGCCAGTCGTCTTGATCCAGGTTTACGAGGGAGAGCGTGCCATGACA
AAGGACAACAACTTGTTGGGCAAGTTTGAGCTTACTGGCATTCCCCCAGC
TCCTCGTGGCGTTCCTCAAATTGAGGTCTCCTTTGAATTGGATGCCAATG
GTATCTTGAAGGTTTCCGCTGCTGACAAGGGCACTGGAAAGTCTGAGAGT
ATCACCATCACCAACGAGCGAGGTCGTCTTTCCCAGGATGAGATTGACCG
CATGGTTGCTGAGGCTGAGAAGTTTGCCGATGAGGACAAGGCCAACCGTG
AGCGTATTGAGGCCAGAAACGGTCTTGAGAACTACGCTTTCACTATCAAA
AATCAGGCCAACGAGGAGGAGGGTCTCGGTAGCAAGATTACCGATGACGA
GAAGGAGACCCTTCTCAACGCTGTTAAGGAGGCCACTGACTGGCTTGACG
AGAATGGAAGCACTGCTACCACTGAAGACTTTGATGAGCAGAAGGAGAAA
CTCAGCTCGGTCGCCTATCCTATCACCAGCAAGATGTATGAGGGTGCAGG
TGGTTCTGACGATGACGATAGCATCCCTGACCATGGGGAACTATAAGCGT
GATGGTTTGATGTTTTTGTTTTTTTCCGGTTTATATAAAATTTCTTGCGG
GCTGAGGAGGTGTTAGGCCCGGCTAGTGTTAGATGGAGGAGCTATGATTC
CTCGCCTTGTATGTAAAAACAGCGGTTTTTCCTTATGTTAAAGGGGTTTG
TTTGAATACACGTTTTATGACTGGTTG

Sequences in the Contig:

SY0AAA12YM06FM1 SY0AAA12YM22FM1 SY0AAA14YC03FM1
SY0AAA15YD08FM1 SY0AAA19YG07FM1 SY0AAA1YC09FM1
SY0AAA1YE15FM1 SY0AAA28YL24FM1 SY0AAA29YE10FM1
SY0AAA31YI13FM1 SY0AAA31YI17FM1 SY0AAA31YI17RM1
SY0AAA34YA15FM1 SY0AAA34YM05FM1 SY0AAA42YC24FM1
SY0AAA42YP14FM1 SY0AAA44YE24FM1 SY0AAA53YA21FM1
SY0AAA54YH22FM1 SY0AAA62YH05FM1 SY0AAA62YH14FM1
SY0AAA8YB12FM1 SY0AAB13YO07FM1 SY0AAB28YF19FM1
SY0AAB29YH16FM1 SY0AAB30YD14FM1 SY0AAB32YK14FM1
SY0AAB35YE17FM1 SY0AAB39YF14FM1 SY0AAB40YA01FM1
SY0AAB41YE04FM1 SY0AAB48YO11FM1 SY0AAB50YE05FM1
SY0AAB59YF06FM1 SY0AAC10YF16FM1 SY0AAC10YI22FM1
SY0AAC10YN14FM1 SY0AAC10YP16FM1 SY0AAC11YF16FM1
SY0AAC11YP16FM1 SY0AAC12YM07FM1 SY0AAC19YI23RM1
SY0AAC23YP16FM1 SY0AAC27YO23FM1 SY0AAC3YF24FM1
SY0AAC47YN16FM1 SY0AAC49YL09FM1 SY0AAC58YO14FM1
SY0AAC60YE02FM1 SY0AAD17YP12FM1 SY0AAD18YM22FM1
SY0AAD19YH11FM1 SY0AAD22YH18FM1 SY0AAD22YN19FM1
SY0AAD26YA24FM1 SY0AAD26YJ24FM1 SY0AAD31YE07FM1
SY0AAD34YF05FM1 SY0AAD40YC16FM1 SY0AAD40YE04FM1
SY0AAD43YI18FM1 SY0AAD47YG21FM1 SY0AAD50YI02FM1
SY0AAD51YA02FM1 SY0AAD51YM18FM1 SY0AAD5YG01FM1
SY0AAD5YK04FM1 SY0AAD60YC05FM1 SY0AAD6YL11FM1