Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1049
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00005116001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001539679.1| Score: 400 E_value: 2e-37
KEGG Definition: hypothetical protein
Accession: ani:AN6595.2 Score: 397 E_value: 3e-37
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0016 Score: 305 E_value: 6e-29
PFAM Definition: ECH, Enoyl-CoA hydratase/isomerase family. This family contains a diverse set of enzymes including: Enoyl-CoA hydratase. Napthoate synthase. Carnitate racemase. 3-hydoxybutyryl-CoA dehydratase. Dodecanoyl-CoA delta-isomerase..
Pfam Number: pfam00378 Score: 185 E_value: 6e-15
Swissprot: Q05871|ECI1_YEAST
Gene Ontology:
GO:0005777 = Cellular component: peroxisome
GO:0004165 = Molecular function: dodecenoyl-CoA delta-isomerase activity
GO:0006635 = Biological process: fatty acid beta-oxidation

Sequence:
>Contig1049
TTGGACGTACAAGAGCGACTGGGGGAAACCTTCTTCGCTGGGGTACGATA
GAAGGTGTCCCATACAACCCCACGCCACCCCATTACTGCAGTCCCCAGTG
TTCTCTACAAGCCATCAATTAAGACACTCTCTACATTACACTTCAATACT
GTACAGTACACACCGAAGGACGAAGCTATGTCAGAGCCCATTTTGCTCGA
AGTCAAGAAGGTAGAGCTGTCATACATCGACCTGCCACACCGTAGCGCAT
GGTAGAGCTAACGTCGGGGGCAAATGATAGAATGTCGCCCTCATCACCCT
CAACCAGCCCAAGAAACTCAATGCCCTGACCGGGGACCTATACTTCGGCC
TCGCGCAGGTAATGCACAAGGTAGCCGCCATGGAGGAAGTTACAATAACG
GTGTTGACGGGAACGGGGCGGTACTTTTCAGCTGGAGTAGACTTGTCTTC
GGTGCTTGGTGAAGGGAGGGACGATAATGAGCGGAAACACTATTTGAGGC
GACTCGCGGCGAACAATATGGAGGTTACCAAGGCATTCTTCGAGCACCCA
AAGATTCTCGTCGTGGCGCTTAACGGTCCTGCTGTTGGTCTCTCTGCTGC
GCTTGTAGCTATGGCAGACTTCATCTACGCTACGGAGAAAACCTTCATCC
TAACTCCCTTCACCTCCCTCGGCCTCGTCG

Sequences in the Contig:

SY0AAA40YI12FM1 SY0AAC55YJ14FM2