Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1048
Length(NT) : 1867
Best Gene Model Blast : Link to GSTUMT00001453001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57760.1| Score: 220 E_value: 9e-16
KEGG Definition: predicted protein
Accession: aor:AO090003000596 Score: 220 E_value: 4e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1048
TTGGTTTTGATTTTTTGTGGGGGAAGGCTTCTTCTGGTTGCGGACGACCA
CCACTCTCTCTTTCTCTTGGGATTTCTTGTTTTTATTTGTGAAAGAGGGA
GAAAGTATTTCCTTGCCTCTGCGCAATCTCCTCATCAGTCCTTCCCTTTA
AACCCTTTCTCGACGTTCTTTTTGTCAATTCGGGTCGCATCCAAATCTGC
GTCTACTATTTTCGACTCTATTCCTGTCCTTCCTACGAAGTTTTCAAGAT
TTCCCCTGCGTTGCCCCTCGCCTCTGCCTCCGCTTTGTGTCATCCGCACA
CAGCAGACGTCGACGGGCGGTAGTAAAGCAGGCAGCTAGCATCAACACAG
CGGCTGTAAATATCCTCCGCCACCGCCTAGATCGAGTCAGAAAACGTGGA
GGGAGTAAATACCTGAAAGAGAGAGGGGGATCGTCCAGGGGCAACTGAAG
AGCGATTAGATATAAGGGGTTCAAGAGGGCTAATTTTTGTGAACTTTTTT
TCTCTATGACGATGACTATCAGTCTCACAACGATGTTTAATCGTTTACCC
ATTTACACACGGCCAAAGGAACCGGCTATCGGATATCCTGTTCTTATAGA
GAGCACCAACCAAACCTTGACCGGTTTGCCGAGCTCGCAGATTGTTGGCT
TCCCACAATATTTGGGCGGCAGCAGCGCTCTCAGGAACTCTAACGAGTCG
GCTTTTAAAGGACCATCAGAAAAACCGGTTTTATCGTTAAATGCTGGTAG
CCACCAAAGCCTTTATGACGATGATCTTGCTCCTCCTCCGCCGCTTAGGA
TCAACACCCTCCAATATCCTTCTCCGCCTGGCTCTTCAAATTCAAACCGT
ACTGTCGGGCCGGGTTCTAATAAGCAACTCAATATCCCTAATCACACTAT
GAACGCCCCTCCGCGAAAACTTAATATTACGCGCAAACCAGCGCCATCGA
GTTTTAGCGGTGCCAATCCGACACATTCGACACATTCGACACACTCATCG
GACACATTCATTGCATCTGGTTTGGATAAAGCCGCTACCATAGATTTTTC
ATCTTCATCTTCTTCGCATGTTCAGCCCCGTGGCCGAGGATTTGGGTTGG
GAAACGTTGTCAAGGGGAAGGTGGCCAGTCGCAAAAGACATGATTCGGAT
TTCGGAGCGGAATCGCCGATCCCAATTGCTGCGGTGAAACCACCGAATTT
TGTTTCGATCGATGATTGGTTGGACAGTCGTGAGCGTGAGGGGCTTCATC
GACGGTCAAACACCGTTTCCACCGTTGCTACTCAAGTTCCCAGATACAAC
GACCCCATCAAACTTCACCTCCGTCAATCCACCTTTGCGCCTCTTGCTCC
TCCCACCGAGATGTCACTTAACGATTCTCCTGCCGTGCCCTCTATTCCCG
CGCAATACCTTCCCGCGCCCCGCTCAGACTCAATCCGTGCTGTCTCGGCC
CCGCTTCCCCCGCATGAAATTCATCCGATACAACGTCCCGCGTCTGTTCC
CAAGGACGAACCTCAGGAACCTAAGGATCATCTCTCGCAGCTCGAATTCG
AGCAGGACCAACTTACTATGCGTCGCGCCGCGCTCCGCCGCGAGATTTAC
GACCTCGAGCAAGTCCTCCCGCCGAACCCCAGCACTCACAACCCTGTTGC
CAGACGAGAAATGCAGGCCAGAAGAGACCAGCTCGTTCAGGACCTCGCGG
ACGTCGAGAAGGACCTTCACGAAATGGGAATGAAGCTGCATAGAGCCTGG
AGACGAAGAGATAAGAAAATGGGTACCGAGGGGCCTACGCACTTGTGGGT
TTCTAGAGTCACTGGCAGCGGGGATGAATAAAGTCGTATCTTATTCCCCC
CCTTTTTTCTCTCTTTT

Sequences in the Contig:

SY0AAA40YI10FM1 SY0AAA44YB20FM1 SY0AAB23YC16FM1
SY0AAC18YN07FM1 SY0AAD63YK06FM1