Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1047
Length(NT) : 1384
Best Gene Model Blast : Link to GSTUMT00001621001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_502922.1| Score: 1209 E_value: 1e-130
KEGG Definition: hypothetical protein
Accession: yli:YALI0D17028g Score: 1209 E_value: 1e-131
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Amino acid transport and metabolism].
Kog Number: KOG2575 Score: 1343 E_value: 1e-149
PFAM Definition: Alg6_Alg8, ALG6, ALG8 glycosyltransferase family. N-linked (asparagine-linked) glycosylation of proteins is mediated by a highly conserved pathway in eukaryotes, in which a lipid (dolichol phosphate)-linked oligosaccharide is assembled at the endoplasmic reticulum membrane prior to the transfer of the oligosaccharide moiety to the target asparagine residues. This oligosaccharide is composed of Glc(3)Man(9)GlcNAc(2). The addition of the three glucose residues is the final series of steps in the synthesis of the oligosaccharide precursor. Alg6 transfers the first glucose residue, and Alg8 transfers the second one. In the human alg6 gene, a C->T transition, which causes Ala333 to be replaced with Val, has been identified as the cause of a congenital disorder of glycosylation, designated as type Ic OMIM:603147..
Pfam Number: pfam03155 Score: 1189 E_value: 1e-131
Swissprot: Q12001|ALG6_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0042281 = Molecular function: dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase activity
GO:0009060 = Biological process: aerobic respiration
GO:0006490 = Biological process: oligosaccharide-lipid intermediate assembly

Sequence:
>Contig1047
TTGGGCAAAAGTTACGAGTAGGGCTACGGTATCATACAGTAACAGCGGGC
TACAAGAACGGCTACTTTTCGCTCCATCCTCCCGTTCGATCTTCAATGAC
CCTGCTTCACAATGTCTTCACCACAGCATGGAGCTTATAAGCCGCGTACG
AAGAAGCCCAAGGCCACCCGCTCCGTCTCATTTTCTCTGCCTGCGCTACC
GTTCCCCTTAGCATCGTTTTTACACCCGCTTCGCTCGGCTTCGTCCCAAT
GGCTTGTTCTACCGGTATTACTTATGGTTTCGATTCTATTCCGATGGGCT
GTTGGGTTGGGGCCTTATTCCGGAATGGCGGCACCACCGATGCACGGTGA
CTTTGAGGCTCAGAGACACTGGATGGAAGTCACGACGAACCTACCCGCAA
AGGAATGGTACTGGCATGATTTGGAGTGGTGGGGATTGGATTATCCTCCC
CTCACGGCTTACCATAGTTGGCTTCTTGGAGTGATTGGTGGTGTGATTAA
TCCGGATTGGTTTGTGCTTTTCGCCTCCAGAGGATTGGACGATGTCGCAT
TGAAGACTTTCATGAGAGCTACTGTGCTAGCCTCCGAATTTTTGATCTAT
GTGCCGGCGGTGGTAATTTTTGTCCGAGCCTTTGGTAGGCAGGCGGACTT
GAGCAAATATGATAAGGGAGTTGCGCTTGCGGCGATTCTGATGCAACCGG
CTCTCATGATTATTGATCATGGACACTTTCAGTACAACTCGGTCATGCTC
GGGCTTACTCTTCTCGCAGTTGATTGCTTCATTACCGAGCACATTTACTG
GGGCTCCTTCTTTTTCGTCCTCTCCATATCCTTCAAGCAGATGGCGCTTT
ACTACGCACCAATTATCTTCGCCTACCTTCTCGGACTTTGCGTGCACCCC
AACACCAACATTCCAAGACTCGTTCTTCTAGGAGCAACTGTCATCGTCAG
TTTTGGTCTTGTGTTTGCACCACTAGTAGTTTTCGGAGGAAAGGAGCAGA
TTGCTCAATGTTTGTTCCGTGTATTTCCGTTTGCTAGAGGGCTCTGGGAA
GACAAGGTTGCCAATTTCTGGTGCGCTGCCAATATACTTATCAAGTTCCG
GGAAAGGTTTGATTCGGGAATGCTCCAAAAAGCTAGTCTCATTGCGACAT
TTGTGGCGATCCTCCCACCCTGCTCGATACTGTTCTTTAATCCTCAAAAG
AGGCTACTGCCCTTGGGACTTGCAGCATGTGCATGGGGCTTTTTTATGTT
TTCGTTCCAGGTTCATGAGAAGAGTGTCTTATTGCCATTGGTGCCTACCA
CCCTCGTGCTTGCCGGGAACTTGGACAAGAATACTGTTTCCTGGGTTTCG
TGGATGAACAATGTTGCTATGTTTAGCATGTGGC

Sequences in the Contig:

SY0AAA37YM12FM1 SY0AAA40YH18FM1 SY0AAA41YI12FM1
SY0AAA41YP01FM1 SY0AAA43YL12FM1 SY0AAA54YD14FM1
SY0AAA60YK24FM1 SY0AAC62YJ09FM1 SY0AAD55YB12FM1
SY0AAD8YF24FM1