Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1046
Length(NT) : 1708
Best Gene Model Blast : Link to GSTUMT00006064001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_12331
Accession: ref|XP_001549161.1| Score: 256 E_value: 5e-20
KEGG Definition: hypothetical protein
Accession: ang:An15g01550 Score: 246 E_value: 4e-19
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 122 E_value: 4e-07
PFAM Definition: No Hit Found

Sequence:
>Contig1046
TCCGCCGCTTCTGTCGAAGTCCATACAATCCCGCCGCCTCACGACAAAGG
TACCCACGCGCCTCCGCGATCCTCCCATGCAACGTCTTGCTCCTGCTAAT
CCGGCGTTTCGTCTCGCGCTGAACGCTCGACACCTCCGCTTCCAGCTGAT
CCCGCAGTCCCATAGCTCCCTCCAGCACCGCCCGCCTGCGCTCGTTCTCA
CGCCGGAGCTCTTCCACACGGACCACGGCTGCTTCCCGCGCCGTGGCGAG
AGAGGCCTTTCGGCCGCGGATCTCGTGGAGCGTCAGTTTGAGTTGGGCGG
ATTCGCGCTGCTGGGTTGCCGTCTGTCCGCTCGGCGACTCAAGGTGCTCA
TGTATCTTGTCGGACAGGGCGTCACGCGCGGTGGTTCGCAGGAGGAGGTC
GTAGCGTTGCTTCCAGAGAGTGATGCGGGCGCAGGAGACGCAGGTTATTG
TGGGCTTGTCGAGAGTGCAGATTGAGCACTGCATTTGCGCCTGTGGTTTT
GTGTGTGGTGGGGTTTGTTCCAACTTTTTTGTACAAAGTTGTCCCCCCAA
CTTTTTTGTACAAAGTTGTCCCCCAAGCTTTACCATCTCCATCGTACGGA
TGGCCAAACACCTATTAAACTTTACATTCGTCTGGTGGGAGAAAATGGTG
AGAGAGTGATGGTACGTGTTGGTGGTGGATGGGCGGATTTGGCGGAATAT
CTCAAGGAGTATGTAACGCACCATGGGTCAAAGAGAAGGGTTGTTTCAGA
GGGCAGAGTGGAGATTCAAGATCTTTCGACCCATAGTCACCACGGCCGGA
CATTGCATCCATCTAGGTCTATATCTTCCTTCCGGAGCGTGAGCCCCGGG
CCTATGGGTAGTCGACCCAGCTCTCCAGGTGGCAATCGTCCATCAACATC
GCTCAGCATGCGGCGCCCAGAAAGCCCCATGTTGATGAAGCGATCAGAAA
GCGAAAACCCGTCACTACAGATCAACCCAACAACAATGCGAGGTGGGCAT
AACGGCACTTTGCCTGGGAATAATAAGACATCACCAACAACCCCTCCCGA
CGAAGCCTTCCCACTGCATCCGCTCACAGCCCCCCAGCTAACACCACCGA
ACCGTAGTTCGCCGTCTAGTCGCCCAGCTTCCCGCCCAGGCTCATCTTCA
TCTGCTGGCTATCGAAGACCCACTTCCCGACTCTCTTTCTCGGAATCAGC
ATTCGGCGACTGCGGTTCTGCAAACGGGTGCTCACCGCCGTCACTACTTC
CCCCGCCACAACCACTTGGTCTCGCCGGTCCAAAGGGAAAGTATGTGCAC
CCGGATAATCAAGCTTGGGTTGAAGGCATGTTAGGGCAGGTTAGGAAGGC
TAGCGCGGACAGGAGAGCGCAGTTACTCGCTGCCACGGGGCATTATGGAG
AAGGAGGGGCAGAAGAGGCGGTTGTCGAGGGGTCCATGGTTGTAGGCGGA
GGAGGGGGGGATTATGGTGGGAGGGAGTTTGGAGGTAGGTTGGGAGAAAT
TGGAAAGGCGGGGGGGACCAAAAGGCTGTTTGCTAAGAAGGGATGATTCT
TGATTTCTTTTTATTTTAAGTAAAGCGTTTCATTTGTTTCGTTTCATCTG
TCTGGGTGTTTGGGGGTTGGAGTTTGCTTTTTTCCTACGTTTTCTCGTTC
ACTAATCATTAATTTCCTTTTAATGTGTGGTTTTTCGCGAGGATTTCACC
AGCTACCG

Sequences in the Contig:

SY0AAA40YH17FM1 SY0AAB60YC16FM1 SY0AAC27YJ18FM1
SY0AAC50YA06FM1 SY0AAC54YE07FM1 SY0AAD36YF20FM1