Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1045
Length(NT) : 993
Best Gene Model Blast : Link to GSTUMT00000912001 E-value : 1e-131
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN1905.2
Accession: ref|XP_659509.1| Score: 216 E_value: 1e-15
KEGG Definition: hypothetical protein
Accession: ani:AN1905.2 Score: 216 E_value: 5e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P40381|SWI6_SCHPO
Gene Ontology:
GO:0005721 = Cellular component: centric heterochromatin
GO:0031934 = Cellular component: mating-type region heterochromatin
GO:0005724 = Cellular component: nuclear telomeric heterochromatin
GO:0005515 = Molecular function: protein binding
GO:0030702 = Biological process: chromatin silencing at centromere
GO:0030466 = Biological process: chromatin silencing at silent mating-type cassette
GO:0006348 = Biological process: chromatin silencing at telomere
GO:0007535 = Biological process: donor selection
GO:0008104 = Biological process: protein localization
GO:0007062 = Biological process: sister chromatid cohesion

Sequence:
>Contig1045
TTGGATGAGTCTTCTCCCGCTGACGGTGACTCTTGGACCCCTCCAAAGGG
AAGCTGGGAGGAGGAGATTACCTGCATTGATACAATTGAAAAGACTGAAA
AGGGTCTTGTGTGTTATGTGCAGTGGAACAATGGCAGGAAGTCCCAGCAT
GAGATCAGTACCGTTTATAGAAAATGCCCGCAGACCATGTTGCGCTTCTA
CGAACAGCATCTGGTATTCAAGGAAAGTGGATCTCTCTAAACCACTTCGA
TACCTCGTCAGAAACAATCGAGAAGCAAAATATACAACAAAGAAAAATTG
AAAAACCAACGGTGAAATTACATTACAGCAAGCCCTTTTTCTTTTAGCAA
GACATTAGCCCAGCCCACCACTGCTTGACCCGACCAGCCTTGCTAGAGTT
GTTAAATTTCCACCTAGCCTAGGAAGGCATTGTTTGCTTTACTTGCTGTC
ATATTCATTTTCTTTGAATCTCCTTTACCTACCTTTTCTATACCTTCTCT
GTTACCTCTTTCTTGCTTCTCTTTGTTTCCCATGTTTGCTCATCTTCTCC
TGATTTTCCTTTCTTGCCTATTTCTTTCCTTTCCTAGTCTACCGGATGTT
CCCGTTTCCATCATTCCGCCTCTGCACCTGTCTTTTAGTCAACGGCTCGG
AAAAAAAAGGCAACCTATCTTTACTTTCAACCCTTGTCCTCTGTTCACAT
TTTTCCCTTCCTTCAGGTTCAGTTTTAGTCTACCTATTGTTTTTTTTCTA
TCCCTCAGGCTCATCTTTGCCCCAGGCACGTTCGAAAAATGGGAAAAAGA
GAAAGAAAGAAAAAAGTCCTCCACCCCCTGGTAGGCAATAATCAAGAAAT
ATCAAAGCACTCACGGTTCGCAATCGGATTGAATGAATGGACGGCGTTAT
TGATTTTTTTTTTAACCTCCTATCTGTCTGACTCTCTGCCTCTTTGCCTG
TTATAACTATAGTCTAAACGTCCTTTACCAAAATTATCTACTT

Sequences in the Contig:

SY0AAA29YF08FM1 SY0AAA40YH06FM1 SY0AAB2YI10FM1