Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1044
Length(NT) : 1036
Best Gene Model Blast : Link to GSTUMT00004926001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SNOG_05312
Accession: ref|XP_001795719.1| Score: 218 E_value: 7e-16
KEGG Definition: hypothetical protein
Accession: ncr:NCU01670.1 Score: 218 E_value: 3e-16
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4102 Score: 210 E_value: 1e-17
PFAM Definition: PPI_Ypi1, Protein phosphatase inhibitor. These proteins include Ypi1,, a novel Saccharomyces cerevisiae type 1 protein phosphatase inhibitor and ppp1r11/hcgv, annotated as having protein phosphatase inhibitor activity..
Pfam Number: pfam07491 Score: 217 E_value: 2e-18
Swissprot: Q6MFY6|PP1RB_RAT

Sequence:
>Contig1044
AGCCCAACAGTTCCTCTCTCTCCCTGCTCCGGCTCCTGCCTACTCTTACG
GCCACCACTACCATCGCCACCTATCCATTTCCACTACAAAAGCTCTTACG
TGCAATTACTATACTCTAACTCAACTACCCTCATCCTCTGGACTCTTGCT
TGTCGTTCCTTCAGCACACCCCCCCCCCAACTCTCCCTCGAGCCGCAGCC
AGCCTTCTTCCTTATCTTCGGCCGTACTTCCCCATCGCTCAAGTCCTTTC
TTCGTCTCGCTTGCTCACTGCCCTCGATTCATCCACCTGTCCCACGATCT
TCACCTCCAGCACCGCCCTCACAATGCTCCTTCCTCCTCCAGACCGCCGC
GAGTTGGCCCCTGCTCTGCCATCCGCTACACAAACCGAAACAGATCCTTC
GGTGCAAACATCGATCCGCTCAGTAAGAATTCCCGATGGCACACTCAGAC
TTCGTGGTGGCCCGGTCGAGAACAGGCGGGTAAGATGGGATGCTGGTGTT
ATTGACAATGAAGGCATGGGGAAGAAGAAGTCAAAAGTATGCTGCATTTA
TAGCCGTCCCCGAGCATACGATGAATCCTCAAGTGACGAGAGCGACTCTT
CCTCCGACGAAGATAGTGAAAATGAGGGACATGGCCATACACACAATAAA
AATTGTGGACATGGTCCCAAGAGAAGCGCAAAGGGGAAGTCAAGAGACAG
CAAGCGAGCTCCCAATCCGAACGCATACGAGAAGATGCCAAAGCCGGCGA
GAAAGAAGTCGGCAAACTGAACCCTAATCCGGGTGTCAGAAACAACAACC
TGTTAGACAAAACTAGGCGGGGAACGGTGGGATATGCATTTGCGGATAGA
AAAAGCTCGGACAAAAAAGGGGGGGAGAGACTCATATGCCTCTAATTTTT
CTCATGTCCAAATTTTTCTTTCTTTCCGATTTTACCCCCTTCACGATCCT
CTTTGATTCATAGTTTATATTTTTATTTTCATGTTCTGGAGTAACTCTTA
AAGGCGTATTATTGTGGATGCATTCATTAACCTTGC

Sequences in the Contig:

SY0AAA39YL05FM1 SY0AAA40YG05FM1 SY0AAB33YL02FM1
SY0AAD32YD16FM1 SY0AAD42YH15FM1 SY0AAD52YL13FM1
SY0AAD61YN06FM1