Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1042
Length(NT) : 1117
Best Gene Model Blast : Link to GSTUMT00003195001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein An01g12310
Accession: ref|XP_001389637.1| Score: 933 E_value: 9e-99
KEGG Definition: hypothetical protein
Accession: ang:An01g12310 Score: 933 E_value: 4e-99
KOG Definition: No Hit Found
PFAM Definition: Dioxygenase_C, Dioxygenase..
Pfam Number: pfam00775 Score: 438 E_value: 5e-44
Swissprot: Q5PXQ6|CHQB_NOCSI
Gene Ontology:
GO:0018581 = Molecular function: hydroxyquinol 1,2-dioxygenase activity

Sequence:
>Contig1042
TTGGGTTTCCGACACACTTTCCAAGGTGTTTGTAAACACCGACAACATTC
GGCCTCACCTCCCGATCTGTGATTAGGCATCAGGATTCCCGCAAGGATGG
ATTCGACGGAAGAGAATATCACGGCAAGCACCGTTGCCATGGGCTCCCAG
TGTAAAGATGAGCGTCTGCAATATCTTATGGAGCGGCTGGTGACGCACTT
GCACGATTTTGCCAGGGAAACGCAGTTAACAACACAGGAGTGGATGAAGG
CACTGATTTTCTTGAAAGACGTTGGTCAGATTTCTTCTGATACCCGCCAG
GAGTTCATCCTATTGTCAGACGTTCTCGGCCTCTCAACCCTTGTTGATTC
AATCAACAACCCCAAGTCCGCCAACGCAACCGAAAGCAGCGTCCTTGGCC
CATTCTACACCGACAACGCACACTTCACCGAGAACGGGGCTTCCATCGCG
AGCCAGAACAGAGGCGAGCCTTGCCTCGTTCGATGCACACTAAAAGACAC
ATCCGGGAACCCAATCCCGGATGCCACCATCGACGTGTGGGAGGCTGACG
AGACGGGGCGGTACGACACCCAGTACGAGGACGCGGCTGGCCCGGATTGT
AGGGGTGTATTGAAGAGCAATGAGGATGGGGAGTTCTGGTTCAAGTGCGT
GAAGCCGGTTTCGTATCCGATACCGCACGATGGCCCGGTGGGAGAGCTCC
TGGGGGTGCTTGGAAGACATCCTTTCCGCCCCGCGCACTTACATTTCAAG
ATTGAGAAAGAGGGGTTTGATCAGCTTATAACCGCACTCTACCTCCGCGG
CGACCCTTACGAAACCTCCGACGCAGTACTCGGCGTAAAGTCTTCCCTCC
TAGTCACCCCGCAAAAAGTGCAGGACCCGGAGATTGCGGCTAGGTATGGC
ATCAGCGTCAGCGACTGGGACATTTTGTGGGATTTTGTCCTCGTGGGGGA
GGCCGAAGGGAGGCAATTGAAGAAGGATCGGTCCGGGAAGACTGGATACA
CGGTATCTTCTTGATTAGGTGTAATACAATTTCCTCCGGAATTGTTCGAA
TGATGGATTTGGTGGGTGGTTTTTTCTTCTTCCGTTTTCACCTAAAGTTG
CACAGGAAGTCGTCGTC

Sequences in the Contig:

SY0AAA3YH17FM1 SY0AAA40YF16FM1 SY0AAA57YE23FM1
SY0AAB10YG24FM1 SY0AAB18YI24FM1 SY0AAB43YK15FM1
SY0AAD34YB05FM1 SY0AAD43YN07FM1