Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1041
Length(NT) : 1840
Best Gene Model Blast : Link to GSTUMT00002523001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_12200
Accession: ref|XP_001548969.1| Score: 894 E_value: 6e-94
KEGG Definition: hypothetical protein
Accession: fgr:FG03481.1 Score: 851 E_value: 3e-89
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2275 Score: 331 E_value: 2e-31
PFAM Definition: Peptidase_M20, Peptidase family M20/M25/M40. This family includes a range of zinc metallopeptidases belonging to several families in the peptidase classification. Family M20 are Glutamate carboxypeptidases. Peptidase family M25 contains X-His dipeptidases..
Pfam Number: pfam01546 Score: 390 E_value: 4e-38
Swissprot: Q5HKI1|DAPE_STAEQ

Sequence:
>Contig1041
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCTCTCGTTCGATCCCTCTC
ACCCTCCGCCTTACCTTGGCTGTTTGACAACTCGAAGTATCCACGTCTTT
TGGAGCCGTGTTCACGCATTACTCGTCTGTTTGTCTCAATCCCCCATTTC
CTTATCTGCTCTGGAAAATTGAACCATCCCACTTCTTCTCCCCCTTTCTT
CAGATAAAAAATATCAAACTTGATTAAAACATAATCTCAAACTTTCAAAA
TGAAACTCATCGACCCTGCGTCTCTCGGGCTTTTGCTATTGCCGTTCACC
CAATCTCTCCAGCTCCCTTTTGGAATCCCCACTTCGGTCCGGGGGATACG
CTCGACTCTGGGAGCCTCCTTCAAGGTCCCTGAATTTATCAAGAAATTCG
CCGACCCAATAAGCACTTCACCACTCTACTCCTTGCACCGTTCACTCATC
GAAATCCCCTCCATCACGGGAAACGAGAAGGGAGTCGGGGAATGGCTCGC
AGGCTACCTCATGGGCAAGAACTTCACTGTGGAGACGCAAGCTGTGAGTG
AGGACAGGGTCAACATATTTGCCTACCTAGGCAAGAACAGGACAACCCAC
ACACTCGTCACTTCCCACATCGACACTGTCCCGCCCTTTATCCCGTACAA
GGCTACTTCCAACACAATTTACGGCCGTGGCTCGAATGACGCAAAGGGGT
CTGTTGCTTCACAGATCACCGCGGTGGAGGAGTTAATCGCTGAGGAGGTA
ATTGCTGAAGGGGACGTTTCGTTGTTGTTTGTTGTCGGCGAGGAAACGTT
GGGGGATGGAATGAAGACTGCGAACTCGTTGGGACCTAGGTGGAAGACTG
TGATTTTCGGGGAGCCGACAGAGAACAAACTTGCCGTGGGACATAAGGGG
ATCGTCATGTTTGATGTCATTGCCAAGGGCAAAGCCTCGCACTCGGGTTA
CCCGCAACTGGGTGTTAACGCTAATAGCCATCTTGTCGAGGCGTTGTACA
AGATTGAGCACATGATCTTGCCGAGGAGTGACATTCTGGGCGAGTCCACT
GTCAACATCGGGTTGATTCAAGGTGGTGTTGCTACAAACATTATCTCTCC
ACACGCTAACGCTTCCGTACTCATCCGTCTTGCTGGGGACTTGGACGAGA
CGTTGGAAGTCATCAAGAAGACTGTTTACGGACTTCCTGTCGAGTTGAGA
TTTGTTGGTGTTGCTTATGGACCGCAGGAAACGGACCATGACGTTGAGAA
CTTTGAAACGATAGTCTGCTCCTATGGAACTGATGTCCCAAACCTGTATG
GTGGCCATAAACGCTACCTATATGGTCCTGGCTCAATCCTCACAGCACAC
AGTGACAGCGAATACGTCCTGAAGTCTGACCTGACTGAAGCTGTCGCTGG
CTACAAGAGACTTATCCAAGAATCCCTCTGGCCGACAAAGCGTGTGCCTG
CTATCATCGAGAAGGTGATCAAGGAGGAGACGGTGATTGCCCCAGTTAGT
CGGAGTGCTACTGTTGGCGATAAGTCTCTATAGGTCGTTGGGATGGGTGT
TGTTTATTTGTGATCGAGAATCGGTGCAAAATCGTGGCTATTCTCTGTTC
TTTTTCACCTCTTTTTTTCCCGGGTACCTCCATCAATCCCGGTGTACTAC
TCGCGGCGGTGGTTTCGTCGCTGAGATAACATTGGTAGATCGGTTTCTCA
TGTTCCAAATGTGGAGTTTTTGCACTTTCTGCGGGCGTACGTTTGGCTTG
GTTGCTATTTTTCTTCTTTCCTCTTCTTTCTTACCGTGGCTTCAGGGTGT
TGGGGTATATAGTATTAATATACACAGGTTCCTTGCTAGT

Sequences in the Contig:

SY0AAA22YK14FM1 SY0AAA22YK14RM1 SY0AAA40YF03FM1
SY0AAC44YA13FM1 SY0AAC62YK02FM1 SY0AAD18YN24FM1