Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1040
Length(NT) : 1387
Best Gene Model Blast : Link to GSTUMT00009052001 E-value : 1e-156
Numbers of ESTs : 12

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001210616.1| Score: 235 E_value: 2e-26
KEGG Definition: unnamed protein product
Accession: cgr:CAGL0B04785g Score: 252 E_value: 9e-25
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3038 Score: 230 E_value: 8e-20
PFAM Definition: No Hit Found
Swissprot: P25554|SGF29_YEAST
Gene Ontology:
GO:0000124 = Cellular component: SAGA complex
GO:0005515 = Molecular function: protein binding
GO:0016573 = Biological process: histone acetylation

Sequence:
>Contig1040
GGGGGGGGGGCGTCATCACCGCTCCACGACTATTTGTTCCCGACATCTAA
GACAAGCCTTCGTTCAACCTCGGTTTCCTTTCCAACCTCTTCCTCGCCCT
CAAACTTCAGTCTGCATGTGCCATCTCTCTTAGTTCCCATCACCTCAGCT
CTATAAAAGGTTGTTGTTTCCGGGTATCTTGCAAGAACTTGTTTGCCAGG
TGGGTAGGGTGGCAGTCCGGCGGAGTCCTTAGGGATCAGGATCAATGCAT
TTGCGGAAGCTTTGTATGTGGTTCCATGACCTCCAGCCTCGTCTGGCTCC
GGATCCTGTACCTCATACCTAAGGGAGTGCTGTGTGAACAGTATTCCTTG
GACATGGTGCAAGGGTGATTTCGGAGTTCATACTTCCGCTTATTCCCATC
CCCGGCGATACCAACTATGATACACTGAATCCACATGCCCTCGGCATTTT
TTTGTTTCGGCAGACGGTATGCAACTTCAGAATCTTTCTGGAGGCCATTG
TGTGGGTCGGGTGCCGCGGACATGCTTCTGGCAACCTTTGTATTTCGACT
GGATGGGCTATCGGCAGCACCAGCGTCGTCGATTTTGCGCTTACGCTTCT
TCTCGCCTGTGGATGGAGAGCAAATTGGTAAGCGTAACTCGAGAAGATAC
GAAACAACCAGTACGGGGAGGCTGAGGACCGGATTGGTACGGAAAACCAG
GAAAACGCCATGAGGGAAAGTATAATTAACAACACACAGCACGAGAGTGA
CGCAAGCTAGTAATCACAAGAGCTACGAAAGGTGAACAGTAAGAAGGATC
AAAATTTCTTACCTCCTCTATCGCCGCCTTCTGTGGCAGTCCTTAGCGCT
ATGAGGAGATCGTTCCACTCCAAAACAGATTGTAGGGTCCTAACGTTCTG
TGAGTTTTTATATAGAAGCCCTAGCGCACTCACTGCCTACAGCTGTTCTT
TGTCCGCAAGCTCTTGATGCTCCGTATATAATTTTTTGAGGATTTTTAGA
TCCTCCAGAGATGCATCTGCAAACGAGGTTAGCAAATGGCACTGATATCG
AACGAGAAAGGCCTCGGTGTATATAAATTGAGAGACCATGCGCAATATCA
GAACTTTTACAGAAAATGTTGAACTGACCGCCTTCTGCATGACGTTCCTC
CTCCCGTTGGGTTTCGGTTGTGAGCACTTGGACGCGCTCGGACATGCGCT
GGAGCTCCTGGAGTTCTCTCACGATCTTTGTCCAGAGGTCGCGCTCCTCA
TGCGCATCGGCCTCTTCCTTCAGGGGGGCTCTAGGGCGATTGCGGGCTGC
CATCATATCCTCGGCGATTCAAGAGGGGATTAGGGGAGAGGAGGCTGAAC
GAATTATAAGAGGCACTCCGATAGATGAGCTGGCCAA

Sequences in the Contig:

SY0AAA40YE17FM1 SY0AAB17YG19FM1 SY0AAC25YO21FM1
SY0AAC53YO08FM1 SY0AAD25YN09FM1 SY0AAD2YG13FM1
SY0AAD30YE12FM1 SY0AAD40YM20FM1 SY0AAD47YG02FM1
SY0AAD50YL19FM1 SY0AAD55YF01FM1 SY0AAD60YO17FM1