Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig104
Length(NT) : 589
Best Gene Model Blast : Link to GSTUMT00007772001 E-value : 1e-127
Numbers of ESTs : 3

Blast Results:

Nr Definition: polyubiquitin
Accession: gb|AAC64787.1| Score: 376 E_value: 1e-45
KEGG Definition: unnamed protein product
Accession: cgr:CAGL0D05082g Score: 376 E_value: 5e-46
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0004 Score: 327 E_value: 2e-31
PFAM Definition: ubiquitin, Ubiquitin family. This family contains a number of ubiquitin-like proteins: SUMO (smt3 homologue), Nedd8, Elongin B, Rub1, and Parkin. A number of them are thought to carry a distinctive five-residue motif termed the proteasome-interacting motif (PIM), which may have a biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites..
Pfam Number: pfam00240 Score: 267 E_value: 1e-24
Swissprot: P61864|UBIQ_YEAST
Gene Ontology:
GO:0022625 = Cellular component: cytosolic large ribosomal subunit
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0016567 = Biological process: protein ubiquitination
GO:0042254 = Biological process: ribosome biogenesis and assembly
GO:0006412 = Biological process: translation

Sequence:
>Contig104
TTGGAAATCACCTTTCTCCCCCATCTACTACGAAACTCTTCTACTCAAAA
CTTCCATTTAGCAAAAACATCTTCCATAAAAACAATCAGCCATGCAGATC
TTCGTCAAAACTCGTGAGTTTATTTAAATAAACCCTTTCATTTCAGCCTT
GTTTTTTTTTTTTTCCTATTGGGAGGCGGGCGAGTTGGAGAAAAAATTCT
AATCATCCTTTTATAGTCACTGGAAAAACCATTACCCTTGAGGTGGAATC
GTCGGACACTATCGACAACGTCAAGTCTAAGATTCAGGACAAGGAGGGAA
TTCCTCCAGATCAGCAACGTTTGATCTTTGCTGGAAAGCAGCTTGAGGAC
GGACGCACCCTCTCAGATTACAACATCCAAAAGGAGTCTACCCTTCATCT
TGTTCTCCGTCTTCGTGGCGGTATGCAAATCTTTGTAAAGACTCGTAGGT
TTCACACATTCCACACCTACGGTGGCAAAATACTAACCCTATGCTGCAGT
AACTGGCAAGACAATCACCCTCGAGGTGGAGTCTTCTGATACTATTGACA
ATGTCAAGTCAAAGATCCAGGATAAGGAGGGCATCCCCC

Sequences in the Contig:

SY0AAA13YD19FM1 SY0AAA14YA20FM1 SY0AAA45YC08FM1