Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1039
Length(NT) : 763
Best Gene Model Blast : Link to GSTUMT00007453001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein CIMG_01719
Accession: ref|XP_001247948.1| Score: 608 E_value: 2e-61
KEGG Definition: proteasome regulatory particle subunit (RpnI), putative; K03039 26S proteasome regulatory subunit N9
Accession: afm:AFUA_6G12770 Score: 600 E_value: 1e-60
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2908 Score: 505 E_value: 5e-52
PFAM Definition: No Hit Found
Swissprot: Q9US13|RPN9_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0043161 = Biological process: proteasomal ubiquitin-dependent protein catabolic process
GO:0051726 = Biological process: regulation of cell cycle

Sequence:
>Contig1039
TTGGTCACATCATAGGAAAGCATTCGACAACCAATTCCTCCCATCCACAA
CTTCCATCCATCGACCTCATCCATTCCATATTCATCTCATATCTACGGAC
CTGCAGCCCCTCCGCTTTTTTACTAAAGGCGAATCATGGATCTCGACCCA
AAACCCATCCCCGAGTTCCTTGCCCAGCAACGAGATGAAGTTGCCCCGCC
CAATCTTCAGAGCCTCTTCTTGGAGTTTGAGGATTTCTGGGAACGCCGCT
TGTGGCATCAACTCACTGAAGCTCTTTTGAAGTTTTACGAGAACCCAGAA
AGTACCCCCCAGCGCATCCCGATATACAAGCACTTTGTCTTGTCATTCTC
GGATAAGATCAATCAGTTGAAGTTTGTAACTCTAGGGTTGTCAGCCGCTA
GGGAGAGCAAAGATAATGATGAAGCTTTGGAGTTTCTTACCACGATTGCT
GCAAAGGTCAACAAGCCCACCTCTAAGGATGCCTACGTCTATGCTACGGT
GGAAGTTGCTAGGGTCAAGCTGCTTCTAGCAGATATGGAGGGCGCAAGGA
AGGCGTTAGATGAAGCGGAAAAGAATCTAGAAACATTTGATTCTGTGGAG
TCTGTTGTTCATGCCTCATTTTACCGTGTGAATGCCGACTACTATAATGC
CAAGCTCGAGTTCGCTGCTTACTACAAGAACGCACTTCTATACCTTGCCT
GCGTAAATGTTGCCGACTTGAGTCAGATGGAGCAACAGGAACGTGCCTAT
AACCTTGCTATCG

Sequences in the Contig:

SY0AAA24YC04FM1 SY0AAA24YC04FM2 SY0AAA40YE08FM1
SY0AAA6YC09FM1 SY0AAC23YC03FM1 SY0AAC39YE06FM1
SY0AAC54YH09FM1 SY0AAD46YM09FM1