Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1038
Length(NT) : 873
Best Gene Model Blast : Link to GSTUMT00005862001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein NCU07688
Accession: ref|XP_962330.2| Score: 564 E_value: 4e-56
KEGG Definition: hypothetical protein
Accession: ncr:NCU07688.1 Score: 564 E_value: 2e-56
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1453 Score: 414 E_value: 2e-41
PFAM Definition: RhoGAP, RhoGAP domain. GTPase activator proteins towards Rho/Rac/Cdc42-like small GTPases..
Pfam Number: pfam00620 Score: 450 E_value: 1e-45
Swissprot: O74360|RGA4_SCHPO

Sequence:
>Contig1038
TTGGGTTCTGATCAGAGAGAGGGTTGGCCCGGTGATCATCCCAATGGCGT
TGATTCGCCCGGCAGTATGAAGCCCGGAGGGCCCGATACACCCGGGGGTA
AAATATTTGGCACACAGAAGAAATGGATGAAGAATAAAGGAGGTCAAAAC
GGGCTCGGCGCGGCTGGATCTACTGCTACTATTAGTGATGGTGTGCTTCC
ACTCTTTGGAACGGATCTCGAGCAACGTGCCGAGTACGAAGGCAATCGCA
TCCCCAATGTTGTCCAGAAGTGTATCCAAGAGGTTGAAGTCCGTGGAATG
GACTTTGAGGGTATCTACCGTAAATCTGGTGGCGCCTCGCAAATGCGCCA
TATCCAGGAGGCCTTCGAGCGTGGTGATGATGTGCCGTTTGATAGCAATG
TTGATATTTGCGGAGTTACCAGTGTCCTGAAACAGTACTTCAGGAACTTG
CCTAATCCTCTGCTGACCTATGACATTTATGAACGCTTTGTGGACACTAC
TACCGTCTTTGAGGAGGAAACCCGCATCAAAATCGTCAAAGACTTGGTCG
ACGAATTACCCCCCATCCATCGCGACTGCCTGCAATTTGTTATTTTCCAT
TTAGCAAGAGTCGCCGCCCGAAGAGATGAAAACCTAATGAACGCCCGTAA
TCTGGCAGTAGTCTTCGCCCCAACTCTCCTACGCTTCACCAGCGATGAAC
GGGAAATGACGGACATGCACGCGAAGAACAATGCCATACAGTTCCTCATC
GACCACAACGAATCCATTTTTTAATCAATGAAATTAAAAACCCGCCACCC
CCCGAAAAAACAAAAGAATGGGGGATCTATTTTCTTTCGTTTTTTACCCC
TCCCCCCATTTTTTCAACCCGAT

Sequences in the Contig:

SY0AAA25YM22FM1 SY0AAA40YD20FM1