Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1037
Length(NT) : 1288
Best Gene Model Blast : Link to GSTUMT00009575001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_07768
Accession: ref|XP_001591143.1| Score: 374 E_value: 7e-34
KEGG Definition: predicted protein
Accession: aor:AO090005000618 Score: 342 E_value: 2e-30
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3292 Score: 361 E_value: 5e-35
PFAM Definition: DUF962, Protein of unknown function (DUF962). This family consists of several eukaryotic and prokaryotic proteins of unknown function. The yeast protein YGL010W has been found to be non-essential for cell growth..
Pfam Number: pfam06127 Score: 356 E_value: 2e-34
Swissprot: P25338|YGB0_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig1037
TTGGCCTACGCTTCCCTGGATTCTCCACACTTCCTCACACACGCGCCTGC
GCAACGTAAAGAAGTTAGAAGAACCACTCAAAATGGGAATCCTAGACCTC
GAACAGCAACTCATTTTCTATGGCTCTTACCACCACACAAAAGGCAACAT
CCTAATCCACCTCATCGGTGTTCCCGCAATAATGGCAACCACATTCCTCT
TCGCAAGCAACACCCCTCCCCTCCTCCCCCTCCCATTCTCAATTCCCTAC
TTCCCCCCAACCCTCGCAACCCTCTCCGCACTACTCTACTCAACCCTCTA
CATCCTTATGGAACCCTTTGCTGGGCTCCTCATAACACCCCTAATTCTGC
TCATGACGGCATTCGTCACGCACCTGACATCTGCCTCCACCACCACGGTC
ACTGCGAACACGGTGGCCGGGTACATCTTTGTGCTGGCATGGATAGCACA
GTTCGTAGGGCACGGCGTGTATGAGAAGCGCGCGCCCGCGCTTTTCGATA
ATCTTGTGCAGGCGGTCTTTTTAGCGCCGTTTTTCGTCTGGTTTGAGGTG
CTGTTTTGGTGTGGGTATAGGCCAGAGTTGAAGGTTAGGGTTGAGGAAGG
GGTTGTAAGGCGGTTGGAGGCGTTCAGGAGGAAGGAGACAGGGAATGTGA
AGGGGAAGGGATAGTAGGGATTGCAGAAGAATGGGGGGAGCGGGTGGGTT
GTGGAATGTGATGGTTTGGGGTGGTGAGGGCAGTGGGGATTTGTTGGACC
ATGATGTTTTTACGCCAGGTGTTAAGTTCTGAGCACGTCACACTACGGTG
ATTGTGGATCCATTCATTTGATGGGTCGGATCGGAGTCATTCGTGCCAAC
TCGCGATCAACAAAATCCCACCGTGCGATTACAACTGGGATACCGTTAGA
GACTTTGATTGATTAAGCCATCGAGTCAAAGTGCCCGGCGCACGACGCTG
GTATTGTAACATAAAATCACCGGTCACGACCATGAATCCCGACGCATAAA
ACAAGGGACCATGTTCATGTAACGACAATGTTTCGTTAAAAAGAGTCAAA
AAGTCAACAATCTAGTAGGTGGATGAGAATAGGTGAATGATATTAAAATT
CAGGTTGCCTCCATTTCCTTTGCTTGGCTTACGTGAACTGTTCATTGATG
CTATCGGTAATATCTACTGATTCTCATCTCCGGGCTATGAGTAATCCCTC
CCTGCAAAGCAATTCACACCTTATGAGAACTTTTGGAAATGGTATATCCT
GCCTTGTTACAACGCTTCAGTCTAATATGTAACCGTGC

Sequences in the Contig:

SY0AAA40YD17FM1 SY0AAA48YA09FM1 SY0AAB47YE23FM1
SY0AAC53YB22FM1 SY0AAD19YO07FM1 SY0AAD21YJ21FM1
SY0AAD3YA15FM1 SY0AAD46YD22FM1