Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1035
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00007911001 E-value : 2e-58
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_07016
Accession: ref|XP_001554428.1| Score: 447 E_value: 8e-43
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 397 E_value: 2e-37
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 252 E_value: 8e-23
PFAM Definition: No Hit Found
Swissprot: Q7T163|ARMS_DANRE

Sequence:
>Contig1035
TTGGGGAAGGTGTCAATCCCGACCTAGCAGGCACCAGGTATGGCCAGTCA
CCACTCTCGTTGGCTGCTGAGTGCGGAAATGATGGGGTCGTAAAGATACT
TTTGGAACGAGCAGATGTCAACCCTAATAAGTTAGACATTAGGTATGACT
GGACACCACTCTCGCGCGCCGCTATGTGGGGGCATGAGGTGATAGTAAAG
ATGCTTTTGGCACGAGCAGATGTCAATCCCGACCAGGCAGATTCCAAATA
TGGCCGGACACCACTCTCGTGGGCCGCCGAGTCTGGACATGATGGGGTCG
TCAAGATTCTTTTGGAACGAGCAGATGTCAACCCCAACAAGGTAGACATC
AAATATGGCCGGACACCACTCTTGTGGGCCGCTAGTTGGGGGCATGAGGT
GATAGTAAAGATGCTTTTGGCACGAGCAGATGTCAATCCCGACCAGGCAG
ATTCCAAATATGGCCGGACACCACTCTCGTATGCCACAGCCACCGGGCAT
GAGGTGATAGTAAAGATGCTTTTAGAACGAGCGGATGTCAATCCCGACGA
GGCAGACACCCCATGCGGCCGGACACCACTCTCGTGGGCCGCTGGGTTCG
CACGCGAGGCGGTATTAAAGATGCTTTTGGAGCGAGCA

Sequences in the Contig:

SY0AAA40YC19FM1 SY0AAB44YK20FM1