Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1034
Length(NT) : 3199
Best Gene Model Blast : Link to GSTUMT00006256001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: AER252Cp
Accession: ref|NP_985109.1| Score: 1420 E_value: 0.0
KEGG Definition: AER252Cp [EC:2.7.7.6]; K03018 DNA-directed RNA polymerase III subunit C1
Accession: ago:AGOS_AER252C Score: 1420 E_value: 0.0
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0261 Score: 1655 E_value: 0.0
PFAM Definition: HSP70, Hsp70 protein. Hsp70 chaperones help to fold many proteins. Hsp70 assisted folding involves repeated cycles of substrate binding and release. Hsp70 activity is ATP dependent. Hsp70 proteins are made up of two regions: the amino terminus is the ATPase domain and the carboxyl terminus is the substrate binding region..
Pfam Number: pfam00012 Score: 784 E_value: 1e-83
Swissprot: Q6BI69|RPC1_DEBHA

Sequence:
>Contig1034
GGCACACCACGGGGAGCGGGGGGGATTCCAGTAAGCTCGAATTTTCCAAG
CAAGTTATTGTCCTTAGTGCGAGCGCGCTCACCCTCGAATACCTGGATCA
ACACGCCGGGCTGGTTGTCGGAGAAAGTCGAGAAAACCTCGCTCTTCTTG
GTCGGGACAGTGGTATTGCGCTTGATCAAAGGAGTCATGACACCACCAGC
GGTCTCGATACCGAGGGAAAGTGGGGCAACGTCGAGCAACAAGATCTCCT
GGGTCTTAGAAGAGGTATCACCAGAAAGAATAGCCGCCTGGACGGCAGCA
CCGTAGGCGACAGCTTCGTCGGGATTGATGGACTTATTGGGCTCCTTCCC
ATTGAAAAAGTCGGACACCAGCTTCTGGACCTTGGGGATACGGGTAGAAC
CACCAACCAAGACAATCTCGTGGACGGAACTCTTATCGATCTTAGAGTCA
CGAAGGACACGCTCGACGGGCTCCATAGTGGAGCGGAAGAGATCCTGGCA
CAACTCTTCGAAACGAGCACGAGTGATCGAGGTGTAGAAATCAAGGGGAC
AACTTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGC
AAACGGCGAACCTATTATTGCAGCTATCCAGGATTTCATCACAGCATCAT
ACCTCCTCAGCAGTAAGGATAGGTTCTACAACAGGAAGGCCTTTGCCAAT
ATTTGTATGTATATGGTTGACGGGAATATGCAAATTGACTTACCCCTACC
CGCCATTTTAAAACCCCAGAGACTCTGGACTGGAAAACAGATATTTAACG
TCCTTATGCGGCCCAACAAAAAGAGCAAAGTTCTAGTCAACCTCGATGCA
AAGTGTCGTGACTTCAAGGCCGTTCCCGCAAAAGCCCCAGATATGTGTCC
CAATGATGGTTGGCTGGTCATCCGTGGATCGGAAATCATGTGCGGACTCA
TGGATAAATCAACTGTCGGTTCAGGGAAAAAGGACTCAGTGTTCTACGTA
ATACTAAGAGATTACGGACCAGATGAGGCTGTCCAAGCCATGAACCGACT
TGCGAAACTATGCGCAAGATGGTTGGCAAATCAAGGCTTCTCAATCGGCA
TAAACGACGTTCTTCCCGGTGCTAATCTAAGGGGAGAGAAGGACAAGCTG
GTAGAACAAGCTTATAATGAGTGCGACGCACTAATCTTGGAATTCAAGGA
AGGGAAATTAGAGAAGCAGGCAGGCTGTGACGAGGAAGTCACACTAGAAA
ATAAAGTACAGGGTATTCTGAGCAACGTCCGTGACAAGGTGGGAGATATT
TGTATGAGAGAGTTGAGCAAGAATAACTCCCCGTTAATTATGGCGAACTC
TGGGTCGAAAGGTTCCAAGATTAACGTCTCACAAATGGTTGCTTGTGTTG
GGCAGCAAGTCATCAGTGGAAAGCGTGTCCCGGATGGGTTTCAAGATCGT
TCACTTCCTCATTTCCCTAAGAATTCAAAGCAACCCCCGTCAAAAGGTTT
CGTCAGAAACAGCTTCTACTCCGGGTTAAGCCCCACAGAATTTCTCTTCC
ACGCTATATCTGGTCGTGAAGGACTAGTTGATACTGCAGTCAAGACCGCC
GAGACTGGGTATATGTCGCGCCGCCTAATGAAATCCTTGGAGGACTTGTC
CGCCTCTTACGATTACACTGTCCGAACATCGTCATCTGGCGTCGTTCAGT
TCCAGTATGGGGGCGACAATTTGGATCCTGTCGCTATGGAGGGAAACGCA
CAGCCAGTTAACTTCAACAGAACCTTTTACCACTGCGAGGTAAGTTCGCC
GTTTTCCCCACTGCGTTCCCTGCTGTATCTCACCAACTGGGTTCAAAGAA
TATCACTTTCAGCAACGCCGACAAGGGTCTTCTCCCATACGAGGTGGTAT
CACTCTGCGATAAAGTTTTGGACCCATTTCAGCAGAAACTGCCCAGAATA
GATCTACTCGGAAATGCAATCCCAGACAAAGACCTAACAGACAGAGCCCT
TGACGAGCACGAGAGCAAGCGGAGGTTCTACAACTCCATCCGAGATTACA
TGGTCGAAAAGGCACGCAAACTTAGCGCATTACGGCTAAGATACAACTTA
CCATCACACGAGGAACCCCCAGACGCAGATTACATGGACGTGGACGACTC
CTTCTTCTTAGCCCACGACGTAAACGCCGTAAACCGCATCATGAAAATCT
CAGAAAAACACCTCCGGGAATTTCTCCGGCAGTGCCTGTCGAAGTACGAG
AAGGCCAAAGTAGAACCCGGGTCAGCAGTAGGTGCCGTTGGCGCTCAGTC
CATCGGTGAACCAGGAACCCAGATGACCCTGAAGACTTTCCATTTCGCTG
GTGTCGCCTCCATGAACGTTACTCTCGGAGTTCCGCGTATCAAAGAAATC
ATCAACGCTTCGAAGGCCATCAGCACGCCTATCATCACCTGCACGCTAGT
GACAGAGGACGACGAGCGAGCCGCAAGAATTGTCAAGGGTAGGATTGAAA
AGACTTATTTGGAAGATATAATATCCTACATAGAGGACGTCTGCTCCCGA
GACGACAACTACATCAGCATTCGCCTGGACCAAGAAACCATCAGCAAGCT
CCAACTAGAACTAACAATCGACGATATCGTAACTGCCCTTGTAAAAGCCA
AGCTGAAAATCATCCGCCAAGACATCCGTGTAATCGGCAACAGGATAAGG
ATCTATGTGCACGAGATGGCGGAGAAGGACCGGAAACGCACAAAGGACGA
GTCGGACGTCTTCCTGCGCGTGCAGAACCTGAAACGTGCGCTGCCGCGCG
TGGTGGTGAAGGGGTACCCGAACGCAGCGAGGGCAGTGGTCAAGAAGGAT
GACAAGACGGGGAAGAACCAGATCTTGGTGGAGGGCTACGGGCTCAAGCT
CTGCATGAACACGGATGGCGTGGTGGGCACGAAGACGAAGTCGAACAGCA
TCATGGAGATGAGGGAGGTTTTGGGAATTGAGGCTGCAAGAGGCTCAATC
ATAGACGAAATATCCTACACCATGCGTGAGCACGGCATGGACATCGACCC
TCGCCACATGCAACTTCTCGGCGACGTAATGACATACAAAGGCGAGGTTC
TAGGGATCACGCGATTCGGACTAGCCAAGATGCGCGACAGCGTCCTACAG
CTTGCCTCGTTCGAGAAGACCACCGACCACCTCTTCGAGGCCGCCTTCC

Sequences in the Contig:

SY0AAA19YE15FM1 SY0AAA40YB16FM1 SY0AAA50YL18FM1
SY0AAA53YA16FM1 SY0AAC1YK13FM1 SY0AAC33YG20FM1
SY0AAD22YK15FM1 SY0AAD34YI12FM1 SY0AAD52YD10FM1
SY0AAD8YF01FM1