Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1033
Length(NT) : 1293
Best Gene Model Blast : Link to GSTUMT00012064001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: GTP-binding protein SAS1
Accession: ref|XP_001585967.1| Score: 921 E_value: 3e-97
KEGG Definition: RAS-RELATED PROTEIN RAB1BV
Accession: ncr:NCU06404.1 Score: 901 E_value: 3e-95
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0078 Score: 803 E_value: 3e-86
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 673 E_value: 4e-71
Swissprot: P17609|YPT2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005525 = Molecular function: GTP binding
GO:0003924 = Molecular function: GTPase activity
GO:0006887 = Biological process: exocytosis
GO:0006893 = Biological process: Golgi to plasma membrane transport
GO:0006886 = Biological process: intracellular protein transport
GO:0006906 = Biological process: vesicle fusion

Sequence:
>Contig1033
TTGGCGACACGGAAGCACCGGTGACTTTTCCATACTAACGAGATAGATTC
CCTTAACATCGACCGTTGAAGAAGAATAACTCTATCCTCCTCTAGTGCAT
AACAATACCCTCAACAACAGTCAAACATCCACCAACCCTCTTACATAAAA
CGCATCACACGAATCAAGGAACTCCTTTCTTTGGTTTTTCCTCTCGATAG
AGGTCTTTCTGTCGCAGTCCACCTCGCAACTTGGCTCCTGGCCCTCACGT
TCTGCTCCTCTTGCACTCCATCCTCCAACTCGCTCCTTACCCCCTCCCCT
TCTTTGATCCTAGTGGAACATTTCCTTTTTTCTCACGGGAAGCCCTAACA
TCCGCCCCATCTACTATTGCATTCCCCCGACCACGGGTCCTCAATCCAAA
CTACTTCCCCTCCACCAAGGTACCACCAACAGAAAAGATGGCCGGTTCAA
GAAACTATGACTTCCTGATAAAGCTTCTCCTGATCGGTGATTCAGGTGTC
GGGAAATCATGCTGCCTTCTCCGGTTCAGCGAGGACTCCTTTACCCCGTC
TTTCATCACCACTATCGGCATTGATTTCAAGATCCGAACAATCGAGCTGG
ACGGCAAGAGGGTCAAGTTGCAGATATGGGATACTGCCGGTCAAGAGCGT
TTCCGAACAATCACCACCGCTTATTATCGCGGTGCGATGGGCATCCTACT
AGTATACGATGTTACCGATGAACGCTCATTCAATAACATCCGAACTTGGT
TCTCTAACGTAGAGCAACACGCTACAGAAGGCGTTAACAAGATATTGATT
GGAAACAAGTGCGACTGGGAAGAGAAGCGAGTTGTATCCACCGAGCGCGG
GCAGCAACTCGCCGATGAGCTAGGAATCCCATTCATGGAGGTATCCGCAA
AATCCAATATCAACGTCGAGAAGGCCTTTTTCAGTCTCGCAACCGACATC
AAGAAGCGAATCATGGATACCGCAAGGGCCGAGGAGAAAGCCGGTGGACA
AGGCAGCGTCGTTGACCCAAGCAGGGACAGCGGAAACATGAGTGGGAAAT
GTTGTTAATTCCTAACCGGTAGAAACTTTGTCTTTCTTCTTGCTCTCTTC
TTCCTTTACGTTTTCTCTTTTTTGTCTTCTATATTCCTTCTATTAGCTTT
ATTTCGCCTCGAACAATGGGGCAGAACTTATCCGAGTAAGTAACCAAGTA
GATCAAAGCTAGACCGGGAATTGGAAGTTGGGGAGATGAAAGGAAAGATA
CGAAATGGATGGGAGGACGAACGGATGGAGGGTAAAGCTACGA

Sequences in the Contig:

SY0AAA38YJ03FM1 SY0AAA40YB04FM1 SY0AAA57YL15FM1
SY0AAA6YJ12FM1 SY0AAB16YI17FM1 SY0AAB43YD11FM1
SY0AAC28YL13FM1 SY0AAC47YP15FM1 SY0AAC58YL16FM1
SY0AAD56YK03FM1