Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1032
Length(NT) : 1027
Best Gene Model Blast : Link to GSTUMT00009538001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 475 E_value: 1e-45
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 422 E_value: 7e-40
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig1032
TTGGATCACGGACTTTCAGTGTGCCTTTGAAATTTCTTGTTACGAGTCGC
CCGTACCACAGAATCGAGGTAGAACTTAGCTCACCCGAAACGACGATCCG
CTTGAAAGGGGAGGACGAACTCGACGCCATTACTTCTGATATTACTCGTG
TCATAGACGAGGGAATTAAGAACCTAGAGTCATACTGGGGACGGCCTGAA
GGGCTGGAATATTTGCGAAATCTCTTAGAATGTTCGGCCGATCGGACATT
CCTATGGGTTTCTCTGATTCTCGGGATTTTGAGGAATAGTGTGGACGACT
CACCGGAAGTGCTTACTACAATTGTCTCCACTGCTCCGCGCGATCTAGCA
GAGTTGTACACCAAGATCCTCGATAAAAGCCCGCACCCCGAGAGCGCCCG
ACGAATCCTGAATATAGTTGTAGCTGCTGCGAGGCCTCTTACACTTCGAG
AAATGAACACGGCATTCAGAATCAGGCCGGAGCACAGCTCGGTTAAGGAC
CTCGGCGATCTTGGTAGTGGAATGGAAAGGACAGTGAAAAATTTGTGTGG
GCTTTTCGTGCGAGTTATCGATTCGAAGATCTACCTGGTTCACCAAACTG
CAAGGGAGTTCTTGATTCGCGAATCATCAGCTGGCCAGGGGAACTGGCAG
CACACACTGTGTCTCGAGGACTCTAATTTCATCATGGCTAACATTTGTTT
CTCCTATCTTTCTCTAACGGAGTTTGAAAACGACCCTTTGTCCGGGAATA
CTTACGGCATGGATTGGCCGTTTCATCGGCGCGAGGTTGATGATTATCTG
GAGAAATATGCTTTTCTCGAGTACGCTGCGAGTCACTGGGCGGACCACTT
TCGCGATTCGCAGGATCGGCAGGTGGAGTTATTCGAGTTGACAAGAGTGA
TTTGTGAAGCTGGGTCTAAACGATCCCAAACATGGTTTAAGGTTTACTGG
GTTAACTCCCGCCACGGGTATGTATGCCCCACAGATTCGACACATTTGAT
GATAGCATCGTGGCTGGGGCAAGGGAG

Sequences in the Contig:

SY0AAA3YP22FM1 SY0AAA54YJ17FM1 SY0AAB15YG10FM1