Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1031
Length(NT) : 1318
Best Gene Model Blast : Link to GSTUMT00000661001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: alpha-ketoglutarate dehydrogenase complex subunit Kgd1, putative
Accession: gb|EDP50530.1| Score: 794 E_value: 2e-82
KEGG Definition: alpha-ketoglutarate dehydrogenase complex subunit Kgd1, putative [EC:1.2.4.2]; K00164 2-oxoglutarate dehydrogenase E1 component
Accession: afm:AFUA_4G11650 Score: 794 E_value: 7e-83
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0450 Score: 722 E_value: 8e-77
PFAM Definition: No Hit Found
Swissprot: P20967|ODO1_YEAST
Gene Ontology:
GO:0042645 = Cellular component: mitochondrial nucleoid
GO:0009353 = Cellular component: mitochondrial oxoglutarate dehydrogenase complex
GO:0004591 = Molecular function: oxoglutarate dehydrogenase (succinyl-transferring) activity
GO:0006103 = Biological process: 2-oxoglutarate metabolic process
GO:0006099 = Biological process: tricarboxylic acid cycle

Sequence:
>Contig1031
TTGGACCGTCAACACCAAGATTGCAATATGCAAGTTACCTACATGACCAG
CCCTTCTAATTTGTTTCATGTTTTGAGAAGGCAGATGAAGCGTCAATTCC
GAAAGCCGCTCATAATATTCTTTAGTAAATCGCTCCTGAGACATCCTATT
GCTCGTTCCGAACTATCCGAGTTTACGGGCGATTCTCACTTCCGATGGCT
TATCCCAGAGACCGACCATGGCAAGGGCATCAAGGATCCCGAGGAGTGCA
AACGTCTGCTCTTCTGTTCCGGGCAGGTTTATGCTGCCCTTATGAAACAA
CGTGCCGCTAGCGGAATTGACGATGTTGCTATCGCTCGTATCGAGCAGCT
TCACCCCTTCCCTTGGGCCCAGATTCGCAACGAGCTTGAGAAATACCCCA
ATCTTGACGAGATTATTTGGACACAGGAAGAGCCTCTCAACGCAGGTGCC
TGGACCTTTGTGCAGCCGAGATTGGAGACTATCCTCCGCCAAACTGATAA
CCACAGCGCAAAGCATGTCAAGTACGCTGGTAGAGCTCCAAGTGCCAGTG
TTGCTACTGGGATGAAGTCGACCCATTTGAAGGAAGAACAGGCATTGGTC
AACGACGCTTTGGGCATTAGCCCCAACTAAAACCAGTCTCACTTTTCCTA
TCGCTTTACAGAATTCGCTTAAACGTTTACCTAGAAACGGGACTATCCAC
TAGATAAATATATAAACAAATAAAGGGGCTGAAGACTCAGCGGGAAGTGC
AGGCTGTGGACTAATGGCGGGCTGTGTTTTGCAATTCTTTTATTTCCTTT
CTTTCGTCCTTTTCTTGATCGGTCACTCGGGATTTCTTCGAGTTTTTTTC
ATCGAGCCCGGGGTGTCGCCGCGTTGCTCGAACAGTAAAAGTCTTACTAT
TATTTTTCCTTGCATTTTTTTCCTTTCCGCTCTATTACCATCATTGCGCC
ATTTCTCTTATCTCTTTTCTCCGGCCGTCATTGTATTACTGGTGTTGTGA
ACTTGTTTCGTTTTATCACTTCTCTTCTCATTAACTTGATTTCAACTTTA
TCTGCCCAGATGCTATATTCCTGTTCCACCCACTACATGAGAGGAAAGCA
GACAAGAGAGTTAGTAGTTTAGCACACTACGATGCGCTACGCTGCAATTT
TTATTATTATATCGTGGCTTAGCATACATTATATTATGTACTTTATTAGT
AGTTTTGGAGGTGATGGCTAGGGAATTACCCGATATACGGTATTGTTTGA
GTATTTTGTTTGGTTGCTGTAATGGGATGGTCTTGGAGGGGGGCAGAAAT
TGATTTTGGGAGAATTTT

Sequences in the Contig:

SY0AAA3YP21FM1 SY0AAB10YC12FM1 SY0AAC17YL19RM1
SY0AAC44YF08FM1 SY0AAC51YH07FM1 SY0AAC8YI01FM1