Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1030
Length(NT) : 1707
Best Gene Model Blast : Link to GSTUMT00009036001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: G6PI_ASPOR Glucose-6-phosphate isomerase (GPI) (Phosphoglucose isomerase) (PGI) (Phosphohexose isomerase) (PHI)
Accession: ref|XP_663641.1| Score: 1369 E_value: 1e-149
KEGG Definition: glucose-6-phosphate isomerase [EC:5.3.1.9]; K01810 glucose-6-phosphate isomerase
Accession: ani:AN6037.2 Score: 1369 E_value: 1e-149
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2446 Score: 1372 E_value: 1e-152
PFAM Definition: PGI, Phosphoglucose isomerase. Phosphoglucose isomerase catalyses the interconversion of glucose-6-phosphate and fructose-6-phosphate..
Pfam Number: pfam00342 Score: 1127 E_value: 1e-123
Swissprot: Q9HGZ2|G6PI_ASPOR

Sequence:
>Contig1030
TTGGGAACAACCCACCTGCATGGGGCCCGGGCATTATCGGACTTCAAGGT
GCTCTATGTTCTGCGCCGTGCTTCTATTGTACCGGCGTTACCAAATTGCT
TAACCCCCCCCCCACTCTCCAGAATCCCCCACATTCTGGAGCCAGAACCA
GCCAGAAGTAGACTATGCAACAAAATGGTGGGGCTCAGGGGGCCCTCTTT
TTTTTCTTCTTTCTCTTCTTCTTTTTTTCCCTTTCTTCCTTACAGCTGCA
TTGCAGGGCAGGGCATGTCGGGAATTTAGCAAATTGTTGCTCACCATTGG
AGAATCTTCGGTGCTTGACTGAAAATCGCGCAATGATGCTTGTGTTAGGG
GTGGCCCCTCATTTTGTTTATCCGTGCATACGTCAGGCAATGGGTGCCCC
ACCAAATGCTTGGTTTGGTTGCTCTTATGTTTGGTCAAACGCAACATATA
CTTCCGCTTCCGCCCTTTCCATCTTAACTTTGCTATCGTTCATTGCGTTA
ACCATCGACAACAGTTGCTCTCTCTAAGCGGAGAAAGACAATCGGTGTTC
GGAATCATCGCTATATCCTTTTGTGTAGGGAAGGTTTCTATTTTAACAAA
TCAAGAACAAGCCATGCCTTTCAGTCTTGCTTCAGAATTGCCTGCCTGGA
AAACTCTCCAGGATCACTATCATACTGTCAAGACATTGCACTTGTCGGAT
TTGTTTGCTCAGGATCCCAAGAGGGCCGAGAAGTTCTCTCGTTCGTTCCT
TAATGATGCCGACGGAAACGAGATTTACTTTGACTTCAGCAAGAACTTTC
TCACGGAAGAGACCCTTGGGCTCCTGATCAAACTAGCCAAGGAGGCTGAT
GTCGAAGGGCTTCGTGACAGAATGTTCAAGGGTGAGAAGGTCAACTTTAC
TGAAGAGAGAGCTGTATACCATATGGCTTTACGCAATGTTTCGAATAAGA
CTATGGAAGTCGATGGGAAGAGCGTTGTTGAGGACGTTAACTCCGTAATA
GAACATATGAAGGAGTTCTCGGAGCAGGTTCGCAGCGGTGAGTGGAAGGG
GCATACTGGTCAGCGCATCAAGAGCATTGTGAATATTGGGATTGGTGGCT
CCGATCTTGGGCCGGTCATGGTTACGGAGACTCTAAAACCTTACGGACAC
CCTGACTTGACCTTGCATTTTGTGTCAAATATTGATGGTACCCACATCAC
CGAAGCTCTCAAGTCTTGCGACGCGGAGTCGACACTGTTCCTGGTTGCTT
CTAAAACCTTTACCACCGCTGAAACTTGTACAAATGCAAACACAGCAAAA
GAGTGGTTCTTGAAGCAGAAGGGTATCGATGGGGATAGATCTGCCATCGC
AAAACATTTTGTTGCTCTCTCTACCAACGAGGCGGAGGTTACCAAATTTG
GAATTAACGCCCAGAACATGTTCGGTTTCGAGTCGTGGGTTGGCGGAAGA
TACTCTGTTTGGTCGGCGATTGGATTGAGTGTTGCTCTTTACATTGGTTA
TGATAGATTCCATGAGTTCCTTGCTGGTGCTCACGCCATTGATAATCACT
TCCTGAGCAAGCCGTTGGAAGAGAATATCCCCATTCTTGGAGGTCTTTTG
AGCGTTTGGTATAGCAATTTCTTCAATGCTCAAACTCACTTGGTCTCTCC
ATTCGACCAATACCTTCACCGCTTCCCTGCATACCTCCAGCAGCTGTCCA
TGGAGTC

Sequences in the Contig:

SY0AAA19YB14FM1 SY0AAA3YP14FM1 SY0AAB54YD16FM1
SY0AAB54YG15FM1 SY0AAB55YF04FM1 SY0AAD55YE04FM1