Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1029
Length(NT) : 953
Best Gene Model Blast : Link to GSTUMT00005852001 E-value : 1e-180
Numbers of ESTs : 6

Blast Results:

Nr Definition: Mitogen-activated protein kinase HOG1 (MAP kinase HOG1)
Accession: sp|Q0U4L8|HOG1_PHANO Score: 519 E_value: 1e-65
KEGG Definition: hypothetical protein
Accession: ang:An08g05850 Score: 510 E_value: 5e-65
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0660 Score: 384 E_value: 7e-38
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 232 E_value: 3e-20
Swissprot: Q0U4L8|HOG1_PHANO

Sequence:
>Contig1029
TTGGCATCTCAGAGAAAAAGCCCCTTCCACTTTCTTCCTGCGTCTAGAGT
ACTCTACCTTCTTACACCCCCCCAATCTCTCTTTTCTCCTCGCCTCCCCC
TTATACTTTTTTCCACCTTTTCTTCCCCTTTGAAATAGTAGAGCCGTACC
TTGAGAGCGCGTTGAAGAATATTATTTTCAACCCCACTTCCGTTATCGAA
TTCATCCTCTCAGCAACATTTTGTTTGCCACACGGGACCTACTCGGGATT
GTACCGTACTTATCCGACGAAACGAAGCGAAACGGCCTGTGTTCTGTTTA
CTACCCACTTGGACCGCTTCAACCTCCCCACCCTTCTCTTCCACCTCACC
CCGCCACTCGTCCATCATCCCAGGAACAACACAGCAACAGTTCCTTGGAT
TACCTCGACCCTAGGCCCTTCTACCTAGTATTTAGCTATACTCTTCCGAA
CCTTTCGACATGGCTGAATTCGTCCGCGCTCAGATCTTTGGAACAACTTT
CGAGATTACAAGCAGATACACTGATCTGCAACCCGTGGGCATGGGTGCCT
TTGGTCTCGTCTGGTAAATACACGAGCCCCCTCCCCCGAATCTGTAACAA
TTCATAGGGAAAATATCGCTGAAAAATTTCCCAAAGCTCCGCCAAAGATC
AGCTGACCACTCAGTCCGTCGCTATAAAGAAGATCATGAAGCCCTTCAGC
ACGCCGGTTTTGTCCAAGAGAACTTACCGTGAGCTGAAACTGCTCAAGCA
CTTGCGGCATGAGAATGTCATTAGTCTTAGCGATATCTTCATATCTCCTC
TGGAGGACATTTACTTCGTCACTGAGCTTCTTGGTACTGATCTGCACCGA
TTATTAACCTCTCGGCCGTTGGAAAAGCAGTTCATCCAGTACTTTCTATA
CCAGATTCTGCGCGGACTGAAATACGTTCATTCCGCTGGCGTCGTTCATC
GTG

Sequences in the Contig:

SY0AAA3YP13FM1 SY0AAA57YC02FM1 SY0AAB45YC05FM1
SY0AAB52YG04FM1 SY0AAC38YD22FM1 SY0AAC38YH20FM1