Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1028
Length(NT) : 641
Best Gene Model Blast : Link to GSTUMT00000329001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_02276
Accession: ref|XP_001596060.1| Score: 453 E_value: 2e-43
KEGG Definition: hypothetical protein
Accession: ncr:NCU05971.1 Score: 416 E_value: 2e-39
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2414 Score: 402 E_value: 4e-40
PFAM Definition: AMP_N, Aminopeptidase P, N-terminal domain. This domain is structurally very similar to the creatinase N-terminal domain (pfam01321). However, little or no sequence similarity exists between the two families..
Pfam Number: pfam05195 Score: 325 E_value: 3e-31
Swissprot: P40051|YEQ8_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004222 = Molecular function: metalloendopeptidase activity
GO:0006508 = Biological process: proteolysis

Sequence:
>Contig1028
TTGGTAACTGCAATGATACTCCGTCGCCTCCGCACCCCCGCACTGCGGAG
CCCTTCCACCTCGGTGGCCACGAAGGTTTTACTCAGAATTGTTACAGACG
AAATTTGGACAGCCGAGCTTCGAGACACACCCCTGGTCGCTCAAGGCCGG
CGAGGTTACACCCGGAATCTCAGCACTTGAGTACGCCACGCGTAGAGCAA
AGCTTGCATCCGAACTTCCTGACGGCGCCGTAGCGGTTGTGCCAGCCGCA
TATGTCAAGTATCGTTCCAGACCGGTGTTTTACCCCTTTCACCAGAACCC
GGATTTTCTCTACCTGACGGGCTTTCTGGAACCGGAGGCTCTATGTGTTA
TCGAAAAGACGGGGCCGGTCGGGGGTGGTGAACATACTTTTCATCTGTTT
GTTCGGGGGAAAGACAGCCATGCTGAGTTATGGGATGGACCGAGGTCTGG
GGTTCAGGCTGCTTTGGATGTGTTTAATGCAGATGAGGCGGGAGATATCA
AACATGCTGAACACCATTTACGGCCTATACTTAAACGCGCGAGCACTATA
TATGCGGATACTATCTCACTAACTGAAAAGCCTTCCGGATTTGCAAGTTT
GATTACTCCGCCGCCAGCAGCTGCACCGGGATCTTTGGTAC

Sequences in the Contig:

SY0AAA3YP01FM1 SY0AAA54YF22FM1