Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1027
Length(NT) : 1293
Best Gene Model Blast : Link to GSTUMT00002394001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein An08g02380
Accession: ref|XP_001392354.1| Score: 338 E_value: 1e-29
KEGG Definition: hypothetical protein
Accession: ang:An08g02380 Score: 338 E_value: 5e-30
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1027
TTGGCATACTCACATACTAGTTGCAATTTGGAGTCTGGAGTGATACTCTC
GGAATCGCGATTCAGGATTTGAGGACTGAGAGGAAGAAAATAAGGGGGAA
AAAGAGAGAAAAAGAAAAAAAGCGACCACGTCTTCATCCGGCCCAACTCT
TACCGTTACAGCACAGTACCATCTCTCCATCGCTCAGCTCCGCTACTCGG
TATGCCAGTTATTCGGAACCCTTTTCGCAGAAATGCGACAGCTCTAGTCA
ATAATCGCTTCGACTCTTTCTCCGACCAGCAATTTACCGCCAGCCCGGAC
ACTGGGAGACTTCCCCTTTCCGAAACTGACTCGAGCACCGACGAGGTGGG
AAGGGCTCATAGTACGAGGGCAAAGTCTGCTAGTGCCATCAGTATTGGAA
AAGAGAGCCAGGACGAAGAGAACACTTACAAGCTAAGCGTTGTTAATGAT
AGCGGTGTCTATTTGCCTCCCTCGCCTCCAGACAAGAAGGGTTTTTGGAG
GAAGAATGATCACTCTCCCCAGACAAAGGTTCCCGATGTCGAGGAGCCGT
TTGTTATATCGAGAGAATCATTTGAATGTTATAGAAGATCATTTGACATC
TCTGCGAGGTCTCCTGTGTTAGATCCACCCCCAGGCCGTGTTAGCTTCGA
CTCGCGTCCTCTTGGTCCGCGCACGAGTCTCGATGTCCGCTCTCCAAGAT
TGCCAATCGTTGCCAAGAATGTGGAGCCCGTCGAAGAGGACAAATTCGAA
GACATCAAGCTCAACGATGATGCACGGCCCAAGAAAAGGAGCATATTCTC
TAGATTTGGCACCGATCACTCCTCATCTGATGCGGCGCTGGCCCCGGCGT
TGGCCCCGGCGTCTCACGGGGTTAGGAACGGTTTTTTCGGAAAGAAAGAG
GTTCCTCAGGAGACGGTCCTTGAAAGCGAGCTCAAGAAGATTGACATCGC
AGAGAATGATAAGTGATGGGAATTGCTATGGGCCTGTCGATATGGATGGG
TAGGTGGATGGTGTTCCGGATTATGTAGGGATTGTTTTGTGACGGATGAC
ACCGCTTTGAGAGGTGTTGGCTGATTGTTGGGCTTTAATGCTTTGGGTGA
TTATGGGGATATATTTCTATTTTCTTGTATGCGCTGGTGCCTTTTTGTTC
CTCTGCGGAAGGTCTAGATCTCTTGTACCCCCTTTTTTATATGCACCCCC
CGAATTGGTTTTGGAAGGAGGTCTCATAGACTCTAATGTATGCTGGAGAC
GGGAGGACAAGGTAAATGTTTAATGAAATTTATCTATGATAGT

Sequences in the Contig:

SY0AAA18YP02FM1 SY0AAA25YH11FM1 SY0AAA25YK05FM1
SY0AAA25YK05RM1 SY0AAA27YD01FM1 SY0AAA27YK14FM1
SY0AAA32YJ19FM1 SY0AAA3YO19FM1 SY0AAA46YO14FM1
SY0AAB26YH01FM1 SY0AAB27YK09FM1 SY0AAD61YO17FM1