Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1026
Length(NT) : 1294
Best Gene Model Blast : Link to GSTUMT00010924001 E-value : 1e-148
Numbers of ESTs : 13

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1026
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGAACCTACAGCGGCCTATCAACCCATACACCATTCACATCCCA
ACAAAGTTACAGCCAAAATGTACCTGTCCACCGTTATGACCGCTCAAATC
CCTGACGTGAAGCCCACACTGTTCGGCCTGTCGTCTCCTAGATCCCCAAC
GAACGGGTATACCTGTGCGTTCCCATCATGGCCGAGTAGGCCGTGCCTCG
ACCGGCGTATGCCGTGGGAAGACGACGACGACGACGAAGAAGAAGTATCG
CATGAGTGCGCTGGGAGGAAGGATGGAAGATGCACTTGTCCTACTGCTGT
CGCCACCGCAGCGCCATCATCGTCGGCGGCAGAAAGATGGGATGGAAGAT
CAGTTTCCAGCACTTGTGCTTCTTCAACCTCATCCACCTCAGCACACGCA
ACGGGGGGGAAGGTAGAAACGCTAATCACCGGCTTCGAAAAATTACCCCT
CCAACCCCGCTCTCCTAGGGCCCCCTCCAGACCAACGAAGTCGTTGTTGT
CGTTGGCGATTCTACGAAAGGCGGGGGGGGATATGTGATGGAGCCGCATG
GCATCATCCCTCATCATACCTTACCTATCACTTTTTTCCTTTTTTACCCC
CATTTTCTTTTCCTATCCTTTTTCGTCCTGCCCTTTTCCGGGATTGAGGG
GGAGGGGGGAAATGGTGTAATACCGGTAGAGTGGGGGGTGTCTTGGTATT
TATGGAGGGATGTCGGAGAGGTTTCTCCGATTCCCGAGTGAGGGGAACTT
ACCATATACCTAATAATACCGGCTGTAATGTTACCGCACGAGTACAGTAC
CTTTATCAGCTTAACCGAATGAGTCCCCAGTTGGGTTTGATCAAGTGATG
GATGATATCCCCGTTTCCATTCCATTCGAATACTCTCCTTCATCACCACA
CTCCGCGACCGATAGGGCACCTACCGGTACGCTGCGTCGCGCTTCACCAC
AACGTTACCGCAACCCCATGAGACGAACCCCTCCTTTAGGCAACACCTTA
TCCGTGCAACCACCCCACAACCAACACCCAACCGCTGCGCCAAGAAATGT
GCCTTGTCGTCTCTTCACCGCATCTCCCTCCCTCATCCACCCATTCATAT
CCCGTTCTAGCTATTCGTGGCAAGCGCAGGGTCTAGCCTACCTCTGCATG
TTGCCTCAATCACTTGACTTGCGAAAGTCTTGTCACCCTTGGTCTCGCAA
TATCAATATCCAGTTTTAGGTACAAATACAAGTACCAACCCGTG

Sequences in the Contig:

SY0AAA3YO18FM1 SY0AAB11YB13FM1 SY0AAB61YN13FM1
SY0AAC35YI16FM1 SY0AAC8YK13FM1 SY0AAD34YJ12FM1
SY0AAD34YP16FM1 SY0AAD39YA20FM1 SY0AAD47YI17FM1
SY0AAD53YK15FM1 SY0AAD55YA12FM1 SY0AAD59YI23FM1
SY0AAD9YN02FM1