Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1025
Length(NT) : 974
Best Gene Model Blast : Link to GSTUMT00003139001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An18g03030
Accession: ref|XP_001398763.1| Score: 737 E_value: 1e-109
KEGG Definition: hypothetical protein
Accession: ang:An18g03030 Score: 737 E_value: 1e-109
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1979 Score: 729 E_value: 8e-78
PFAM Definition: DNA_mis_repair, DNA mismatch repair protein, C-terminal domain. This family represents the C-terminal domain of the mutL/hexB/PMS1 family. This domain has a ribosomal S5 domain 2-like fold..
Pfam Number: pfam01119 Score: 113 E_value: 2e-06
Swissprot: Q9JK91|MLH1_MOUSE
Gene Ontology:
GO:0032389 = Cellular component: MutLalpha complex
GO:0000795 = Cellular component: synaptonemal complex
GO:0032137 = Molecular function: guanine/thymine mispair binding
GO:0008630 = Biological process: DNA damage response, signal transduction resulting in induction of apoptosis
GO:0006303 = Biological process: double-strand break repair via nonhomologous end joining
GO:0045190 = Biological process: isotype switching
GO:0007060 = Biological process: male meiosis chromosome segregation
GO:0043060 = Biological process: meiotic metaphase I plate congression
GO:0006298 = Biological process: mismatch repair
GO:0045950 = Biological process: negative regulation of mitotic recombination
GO:0048477 = Biological process: oogenesis
GO:0000239 = Biological process: pachytene
GO:0000289 = Biological process: poly(A) tail shortening
GO:0000712 = Biological process: resolution of meiotic joint molecules as recombinants
GO:0016446 = Biological process: somatic hypermutation of immunoglobulin genes
GO:0007283 = Biological process: spermatogenesis
GO:0051257 = Biological process: spindle midzone assembly involved in meiosis

Sequence:
>Contig1025
TTGGCCCCTCTGCTTTCTACTTCTCAACTCCCCCCCGATGGATTCCGCAG
ACCCAAGAGGTTCCAAGAGAAAAGCAGACTATGCAGACGCCCCTTCTCCT
GCTTCTGCTGCTCCTCAGCTTCCCCGGAGAATAAAGCCTCTAGACCAGGT
AGTTGTTAATAAGATCGCTGCTGGTGAAATCATCGTGGCCCCAGTCCACG
CACTGAAAGAGCTTATCGAGAACTCCGTTGATGCGGGATCTACCAGCATC
GACATACTAGTGAAAGACGGTGGGCTGAAGCTTCTCCAAATCTCAGACAA
TGGTCATGGAATTGACGAAAATGACTTGCCCATTCTATGTGAAAGGTTTA
CAACTTCGAAATTACAGTCCTTTGAAGATCTTCAGTCTATTGGAACCTAT
GGTTTCCGGGGTGAGGCTTTAGCGAGCATAAGTCACATTGCCCATCTGAC
CATCACGACCAGAACGGCAAACTCACCTATTGGCTTAAGAGCAACGTATT
CAGATTCAAAGCTAATTACTCCAAAACCGGGCCAACCTGCGAATCCAAAG
CCGGTACACCGCAACAAGGGAACACAAATCACCGTCGAAGATCTCTTCTA
TAATGTACCTAGTCGGCGTCGAGCATTCCGCAGCCCCTCAGAGGAATATG
CCAAGATTCTTGGATTTAGTTGGTAGATATGCCGTGCATTGCGGAGGCGT
TGCTTTTAGTTGTAAGAAGTATGGTGATCCAGATGTGGGTGTATCTACAA
CGGCAGGAGCCACGACCACCGATCGTATCCGGCGAATTCACGGCAATGCT
GTCGCGAATGAACTCTTGCCATTTGAAGTTTCAGATGATTACCTTGGGTT
TAAAGCGAAGGGCATGCTAAGTAATGCCAATTATCATGTCAAGAAAACGA
CGCTCCTTCTTTTTATCAACAATCGTTCCGTAGATTCTTCTTCCATCAGG
AAAGGGATTGAATCCACATACGCA

Sequences in the Contig:

SY0AAA3YO14FM1 SY0AAA9YB02FM1