Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1024
Length(NT) : 973
Best Gene Model Blast : Link to GSTUMT00009178001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein MGG_11244
Accession: ref|XP_001413293.1| Score: 195 E_value: 3e-13
KEGG Definition: hypothetical protein
Accession: mgr:MGG_11244 Score: 195 E_value: 1e-13
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3435 Score: 110 E_value: 5e-06
PFAM Definition: Ribosomal_L37, Mitochondrial ribosomal protein L37. This family includes yeast MRPL37 a mitochondrial ribosomal protein..
Pfam Number: pfam08561 Score: 173 E_value: 3e-13

Sequence:
>Contig1024
TTGGAATTTTCACTTCAACATCGGATCCCGTGGAAAGCAAGATATATTGG
CCCCTCCACGTCAATAGCATTCAAAATGTTCTGCGCTCAATGTGTGTTAT
CATCCTCCCGTCTACCACTCATATCTCTCACCTCTCGGTCGTTTGCCACT
GGCCAACTGCCACGAGCTGGTGATGCGCCTCGCCCACCCGCCAAACCAGT
ATCATTAGAACCAGCTCCCTATAGATCCTCTGTTACGGCCGACGGTAAGC
CTCGGGTAAAGAGTGGGACACCCGGCGGAACAGTCCTCAAAAACATCAAC
TTTCTGAAAAATAGATCCGATCCTATTGCGATGGAGGACTCGGAATATCC
GGAATGGCTATGGTCCATGCTCGAGAATAAGACTGGCGCTGTGGGCGATT
CAGCTGCGGCGGGTGATGCATACTCTAAATCAAAAAAACAACGTGATCTT
GCAAAGAAACAGGCTGCGAAGGTTGCCCGTATGGAGGCTAGAAACAAAGA
CGTCCGCATACCTCCTCACCAACAATCTATCGATCTCCCTTTCGCGACAG
TCCCAGACCCGACAGCCCCAAGCTCTATTGTTCGATCGGTCGCTGAACCA
TTCACTAGGGTTGTATCTACTAGCGGAGGCCTCCTTCATAAACTTCCTGC
CATTCCAGGCACAAGAGGGTTAAAGCCAGCAGCAGTGGAGATTGGGAAGG
ATGTTCATGTTACGCCGCTGGAAGCTCAAGCAGCGCGGTTAGAAACTCGG
ACAGCCTTGAGGAAGGCACAAAGGGCGGGTATTCGAGAGAAGAATTTCTT
GAGCACCCTAAAGGTAACGTTGCAAGGGATAGCTTGCTCAAATCATAGGT
TGTCACTCGGAAATCAATATGCCCTATCATAACGTATTCCTTTGGCTTGC
CACTTTGCGGTGATCGCTCGACTGATACCCGTCTAAAAACATGCTGCAAC
CGTTTGACTACCTGTGCTTACGT

Sequences in the Contig:

SY0AAA3YO02FM1 SY0AAC39YN07FM1 SY0AAC58YL07FM1
SY0AAC60YO02FM1 SY0AAD29YH18FM1 SY0AAD38YG24FM1