Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1023
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00007289001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1023
TTGGATCGCACGCTTCACTCGCTATTGCCACAGCAACACCAAAGCACCAA
ACAAAACATCAAACCGTTTAGTATCGCAAATCGAACAATCGACTTGCCTT
AGAACCGGTCGGTGACTACGCTACAAAAGCCTTTCCTACCTGACGAGCTC
ATTGCACTATAATCTCCCATTACCTTACGCACTTCCGAACCAATATCTCA
AATATCTACACAAATGCCTTGCATGACCCGTTACCCCACCCCCCCCACTT
ATATCTCGCCCGGCACCAACACCGCCAATCTGGCTTCTGCCGTCTGCGCA
CACTCAAAACAGGATCGCCGACCCTCGATAATTCAATCTTGTTCTCCGCC
GGTGTCGGATACAACACCTGAACCTGCCAAGTTCATAATCACGTTAAAAG
GCAGAACTGAAGAGAAAACTTTAGTCTCCAAGTGCTCGCCGCCAGAGAGA
TGGTCCGGGGCGGTGGTGACTTCTGAGAGATCAAGCTACATCCATATGGG
TATGAGGCGTCGGGAGTCTCTCCAAAGACCAGGCGTCGAGGGTGAAGGAT
GTTCAGGGAGCGATACTGCGAGTGAGACCGAAAGTTCCTACGGGGGCGAA
AGATTCGGGGAGCGATGCTGCGAGTGAGGCTA

Sequences in the Contig:

SY0AAA3YN16FM1 SY0AAB16YM03FM1 SY0AAB20YN13FM1
SY0AAB51YG20FM1 SY0AAB6YJ15FM1