Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1022
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00003953001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein DEHA0G11539g
Accession: ref|XP_462004.1| Score: 240 E_value: 8e-19
KEGG Definition: hypothetical protein
Accession: dha:DEHA0G11539g Score: 240 E_value: 4e-19
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1981 Score: 129 E_value: 2e-08
PFAM Definition: No Hit Found
Swissprot: P40317|SOK1_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0019933 = Biological process: cAMP-mediated signaling

Sequence:
>Contig1022
TTGGGCCTTCAGAAGGGGAATATGACACATCTTCCGTCAACACTACATCA
ACACAATCAATAGATATACCAGAGTCGAGTTCGCATAATGTAAGCTCGGA
AGTCTCTACTCCCGGATACGAGTACCAATCATCTCCCAATGCTCCGGCGA
AACGGTTAAATGAGTCGGCTCCTCCACCAGAGACAATGTACCCATTAAAG
CGATTAAAGGTGGAGGAGTCTGATTCCAGCTCGTCCAATTGTTCATTGTC
AGAATGCTCTATGCCCGCAGAAGCCCCAGCACCGGATTCCGAGTCTGAGA
GGTCGTCAAGGGTTAAGGTTGCGGGAAACAAACAGTTCAGATCGAGGTCG
TTACCCCCCAACCTTCGACGGAGAAGACGAACGCAACAGGAAAGCATCCA
ACAGCACATCCCACCTGTCACCCTGAACACCCTGAGAGAGCTCGACTTGC
ATGAGATCTACCGCAATCCTAAGCTTAGACACGACGTTGTTTTCGATTCA
CAGCTTCATTTCCGACCGAATCTTGATGGGACTAGGGGGAGGAGAAAGAA
GGAGATGGCGGATATGTACTGGCAGATCGTCCTGCGGGAGTGTGAGGTGG
TTTTGGGATCATCCAAGTGGAGGAATGCCGAAATGTTCTCGACAACACCG
AGGAAGCTACCGATCTTATT

Sequences in the Contig:

SY0AAA3YM13FM1 SY0AAA58YM15FM1