Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1021
Length(NT) : 751
Best Gene Model Blast : Link to GSTUMT00008493001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein FG04187.1
Accession: ref|XP_384363.1| Score: 542 E_value: 1e-53
KEGG Definition: hypothetical protein
Accession: fgr:FG04187.1 Score: 542 E_value: 5e-54
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG3042 Score: 491 E_value: 2e-50
PFAM Definition: Pantoate_ligase, Pantoate-beta-alanine ligase. Pantoate-beta-alanine ligase, also know as pantothenate synthase, (EC:6.3.2.1) catalyses the formation of pantothenate from pantoate and alanine..
Pfam Number: pfam02569 Score: 511 E_value: 1e-52
Swissprot: P40459|PANC_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0004592 = Molecular function: pantoate-beta-alanine ligase activity
GO:0015940 = Biological process: pantothenate biosynthetic process

Sequence:
>Contig1021
TTGGCTGGATTGACCTCTCCGCCAAATGTCATGAGAATCCCCTAAATCAC
AGAGACTATGATCCAGACGTCAATATCCCGTCAACCTATGAATTAGTCAA
TTGATTATGATACAACTACTTCGGCGCTTTGCTTCCCTAAGTGCTCTCAC
AAAAATAACATCCACAATGACCACCCCACTACCGGCGACCGAGCCCCCCC
TGACACTATACACCTCTATCGCCTCAATCCGACAATGGCGCCGCGAGCAA
GCGAACCAGCGCAAGAGTGTAGCCATGATACCAACAATGGGCGCTCTGCA
CGCCGGGCACGCCTCGCTGATCCGTTCGGCAGCTCGGACCCACAACAGCC
TAGTGATCAGCATATTCGTCAACCCCGCGCAGTTTGCTCCGCACGAGGAC
CTCTCGCGGTACCCGCGCACCCTGACCGCAGACATCAAGCAGCTGGAAGC
TCTGAACGCAGAGTTATCCTCCCCGGGGTTCCCCTCGAAGGGGAGGATCG
AAGCGCTGTTCGTGCCCTCGGTGCCAGAAATGTACCCTTCCGGCATACCC
CTGCAACAGGAACTTCAGAAAGGAGCATTCGTGACCGTCACTCCGCTGTC
CAGTCGCCTGGAGGGCATCACGCGCCCGCACTTTTTTCGTGGCGTGGCGA
CCGTCTGCATGAAGCTTTTTAATATCCTCCAGCCGGACGAGGCGTACTTT
GGACAGAAGGATGTTCAGCAGACGGTTGTGCTTAGGCGGATGGTTGGCGA
C

Sequences in the Contig:

SY0AAA3YL16FM1 SY0AAA61YI06FM1 SY0AAB22YG20FM1
SY0AAB42YO01FM1 SY0AAB45YK06FM1 SY0AAC35YF05FM1
SY0AAC38YL10FM1 SY0AAD38YC01FM1