Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1020
Length(NT) : 699
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1020
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCATCACGACTTGCTGATGAT
TGCTAGGCTACCTCGGGGGATGAGCTGAGACTCGGGATTTCTGTTGATAT
GCTGAGCCCCTAATGTTGAAACACGCTGAAGCTTGTGTGTGCTCGGTGTG
GTGGTTGACGGGTTATAAGCAGAGAGAAATCCCCTCAATCGGGAGCCTTG
AGGGAAGCTGCGGCCGATCCTTAAAGTCTGCCGGCTCATATCGTACGATA
ATCTATTGTGAGGTTTGCACTGGTACGGTGAGTGTTGGTGCTTCGCTTGG
ATGTCATGTTTGCCTGGGTTGAGCTCTTGGTACGGCATCATGCCCGGAGG
AGGAGCCGGGGAGAAGGGGGGAAAAAAAAAGGAAGGAAATTGCTCAGTCT
CACAGCGCACCGACACAATAGGGCACCGATGAGAGGAGGAATGGGCCAAA
CAGCTGTTGGGTTGATGTCTCTAACGAAGCGCTGAGTTCTACACACTAGT
GAGTTCATACAAGACCCAGACTCCGCCTCTTTTCGGTTTCCCACCTCTGC
CACGCGAATCCGATCAATGGCGGAATAAACCCCCTCTTTTCAGTTGTACC
TACTACTTTGAACAGAGAACCTCAGACTTGTCATGACTATGAGCACGGCG
AAGCCTCTTTCTTCCGGAGTATACCTTAGTTAGGTGCATAGTACCTAGC

Sequences in the Contig:

SY0AAA3YL09FM1 SY0AAA4YL09FM1 SY0AAA50YK20FM1
SY0AAB12YA20FM1 SY0AAC31YN11FM1