Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig102
Length(NT) : 1247
Best Gene Model Blast : Link to GSTUMT00005447001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein MGG_06014
Accession: ref|XP_369450.2| Score: 787 E_value: 9e-82
KEGG Definition: hypothetical protein [EC:4.2.99.18]; K01741 DNA-(apurinic or apyrimidinic site) lyase
Accession: mgr:MGG_06014 Score: 787 E_value: 4e-82
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1921 Score: 851 E_value: 7e-92
PFAM Definition: HhH-GPD, HhH-GPD superfamily base excision DNA repair protein. This family contains a diverse range of structurally related DNA repair proteins. The superfamily is called the HhH-GPD family after its hallmark Helix-hairpin-helix and Gly/Pro rich loop followed by a conserved aspartate. This includes endonuclease III, EC:4.2.99.18 and MutY an A/G-specific adenine glycosylase, both have a C terminal 4Fe-4S cluster. The family also includes 8-oxoguanine DNA glycosylases. The methyl-CPG binding protein MBD4 also contains a related domain that is a thymine DNA glycosylase. The family also includes DNA-3-methyladenine glycosylase II EC:3.2.2.21 and other members of the AlkA family..
Pfam Number: pfam00730 Score: 279 E_value: 2e-25
Swissprot: Q09907|END3_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0034042 = Molecular function: 5-formyluracil DNA N-glycosylase activity
GO:0034043 = Molecular function: 5-hydroxymethyluracil DNA N-glycosylase activity
GO:0034039 = Molecular function: 8-oxo-7,8-dihydroguanine DNA N-glycosylase activity
GO:0006285 = Biological process: base-excision repair, AP site formation

Sequence:
>Contig102
TTGGATACCTTTCTTTGGGTGAAATTTTTTACAGGTTCATTGGATCGTTT
CTCCTACCATTAACACCGGTCTAGACCACTCGAGCTGTGGCGATTAATGG
CGCGAGCTGGAAGAGCTGCGGCGAGAGCAGGGGCAGCTTCTTCCCTTTCA
GCGGTGGTGGCGACGACGGTGACCCGGGTGGCAACGACGAGGCCCACAAC
TATGCAGACGCGTGCGGGTGTGCCCATGGGTGATGATTATTCGAGCTCAG
GGCTTTCTTCCCCGCCATCGGATTTGGGTAATTATTCGGATGAAGAGAGG
GAGGTGAAGAAGGAGGAGGACGAGGAGGAGGGGAAAAATGGTTCGATCGT
TTCCAGGTTCTTCCAATCACCATCGCCGGGGAAGGGTGCTCGGAAGGCTC
CTAGGAAGGCTATCGCTCTCGTGAAGAAGGAGCCGACGCCTGAATTGGGG
GATATAGCGCCGGTTCTGATTAAGGAGGAGAAGGAGGAGAAAAAGGAGAA
AGGGATTGGGCAGAGGAAACCTCGGGGGAAGAAGGTTAAGGATGAAGAGC
ACGTAAAGGTTGAGGCTCCGGAGAATTGGGAGGAGGTGTACGAGAAGCTT
CGGGAGATGAGGAAGAAGGTGAAGGCGCCGGTGGACACAATGGGTTGTGA
GAGGCTGGGGGACAAGGCGGCTACTCCTAAGCTTCGGCGTTTCCACACAT
TGATCTCGTTGATGCTTTCTAGTCAAACCAAGGATACAATCAACGCGGTT
GCCATGAAAGGTCTCCGGGAGCAGCTTCCAGGGGGACTTTGCCTAGAGAG
TATTTTAGAAGTAGAGCCAAAGAGATTGGACGAGCTTATTAGGATTGTCG
GCTTTCACAATCGAAAGACGGAATACATCAAGAAGGCGGCGGTAATCATC
CGGGATAAACATGGTGGTGATATTCCCGATACCTTTGAGGGTCTGACGGC
CTTGCCTGGCGTTGGTCCTAAAATGGCGCACTTGTGCTTATCTGCGGCAT
GGGACCGAACCGAAGGGATTGGTGTCGACGTCCACGTCCATCGGATTTGC
AATCTTTGGGATTGGGTCAAAACCACTACTCCGGAAGGGACTCGGGAAGC
TCTGCAGGCTTGGCTTCCAAGGGACAAGTGGAGGGAGATAAACTTCCTCC
TGGTTGGGTTTGGACAGACAATATGTCTCCCCAGGGGGAGGAAATGTGGA
GAGTGCGCTCTATCGAGTGGGTTGTGCGGGGCAGCATACATGGAACC

Sequences in the Contig:

SY0AAA13YP16FM1 SY0AAA14YH24FM1 SY0AAA45YI20FM1
SY0AAC17YN09FM1 SY0AAC54YE12FM1 SY0AAC54YL02FM1