Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1019
Length(NT) : 833
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1019
TTGGCGGACAATAGGATGCGCGATACCGGTATTATAATACCGGCACTCTG
TCGAGCACGAGTACTGTACGAGTTGAGTGTCGGGTGAAGGTTAACCGCAA
CCGTTTCTTACAGAACGCCATGTGTCGGTGCATATCACGTGTGCCGAAAC
GCTCAAGTCTTTGTGGGAAGCTGTGTAATTCAAAGGTCTCAAAGGAGGGG
AGAAAAAATGGCGCGAAGGACGGATAAAGAGGGAGAGGGTAGGAGAGGGG
AGCGGAGGGTAGGGATGTGTGCGTTTGGTGTGTGGTGCGAGGTGTGGTGT
GTGCACCGGATGTGGATGCTTGGGGTTTGGGGTGGCAGAGGCTGGTAGGC
TGGTGGTGAGAACAAGCATTTTTTCCAAGAGATCTCTATGCTTTTCCCGG
CACGAGTGCAGAATGCTTAGCTGCGAAATTGGCTGAGCTTTTGAAACTCT
CTCTGTCTCTCTCTCTCTCTCTCTCTTTTCTTTTTTCTTTTCCCCCCTTT
GAGGAGGAGGGTAGGGGTGAAGGATTAGCATGGCATACCATAGGGGGCTA
TTGTGTCTTAAGCGAATCGGTAATCGGTAAAGGCTTGTGTCTGTTAGATG
ATGTGTTTAGGTGGGATATGAGAAGAGGAAAGATGGAGGGAGGGATATTC
GAGTACGATAGTCTACAGTATCGGTATGGAGGGAAACAAAACAACCTCTC
GGCATCTTGACCACAGTCCCCTCCCTTACCTTCTTCGCTCTTAATAAGCT
TTTTTGGGAAAAGGAATCGAGGGTTTTTAATTTGCCTGTTCCGTTTAATC
CCAAGCTTCCTTTTGTTCGGTAAACCCCCCCCC

Sequences in the Contig:

SY0AAA33YH09FM1 SY0AAA3YL05FM1 SY0AAC10YK17FM1
SY0AAD12YG08FM1