Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1018
Length(NT) : 732
Best Gene Model Blast : Link to GSTUMT00008539001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 129 E_value: 2e-08

Sequence:
>Contig1018
TTGGCCCCTCCTTGGCCACAACAGCATTCGCTCTGTTTCTGGTCGGACAA
CTTTCGTTTTACAAGGCACATCTCACCATCATGAGATCACACTCGTTCGG
TGCGCTCGCACTCGCCTTCATTGGGAGTGCGACCGCCGCTGTCGAACCCT
ATGGACAATGCGGAGGAACTGGGTATGGCGGCGAAACCAGTTGCCCCCCT
AAATTTACTTGTGTCCGGGTAAACTCTTACTATTCCACTTGTGTGGAGAC
CGAATATTACCCCTCGGTTTATAATCCCACCGCTAGTCAATACACTGACT
CCAACTATCATCCCTCGGGTTATACCTACAACCCATACAAACATTATACG
TCAACTCCCCCAAAATACACTACTAATACATACTACACCCCGCGCCCAAC
CAACACATACAAGTCGTCGGATCCCAAGCACAAGACCGACTACAAGCCAT
ATCCGACTGACTATAAGCCCTACCCATCGGACTACAAACCGGATGACTGT
CAGTCGTATCCGTACCACAAGCCAGATTATAAGCCATCCGACTACAAGCC
GTACCCGGATTATAAGCCGACCGACTACAAGCCAGATTATAAGCCATCCG
AGTACAAACCGTACCCTGATTATAAGCCATCCGACTACAAGCCGTACCCG
GATTATAAGCCGACCGACTACAAGCCATACCCGACCTATAGGCCGGATTA
TAAACCATCTGACTACAAGCCGTACCCGACCT

Sequences in the Contig:

SY0AAA2YG23FM1 SY0AAA3YK07FM1 SY0AAA4YL14FM1
SY0AAA7YA16FM1 SY0AAA8YF02FM1 SY0AAA9YF02FM1
SY0AAB2YC23FM1 SY0AAB39YF04FM1 SY0AAB43YK14FM1
SY0AAB50YI19FM1 SY0AAB52YP15FM1 SY0AAB9YB23FM1