Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1017
Length(NT) : 737
Best Gene Model Blast : Link to GSTUMT00008235001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein AN1372.2
Accession: ref|XP_658976.1| Score: 285 E_value: 6e-24
KEGG Definition: hypothetical protein [EC:3.4.21.105]; K09650 rhomboid-like protein
Accession: ani:AN1372.2 Score: 285 E_value: 3e-24
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2980 Score: 144 E_value: 3e-10
PFAM Definition: Rhomboid, Rhomboid family. This family contains integral membrane proteins that are related to Drosophila rhomboid protein. Members of this family are found in bacteria and eukaryotes. Rhomboid promotes the cleavage of the membrane-anchored TGF-alpha-like growth factor Spitz, allowing it to activate the Drosophila EGF receptor. Analysis has shown that Rhomboid-1 is an intramembrane serine protease (EC:3.4.21.105). Parasite-encoded rhomboid enzymes are also important for invasion of host cells by Toxoplasma and the malaria parasite..
Pfam Number: pfam01694 Score: 139 E_value: 1e-09
Swissprot: P53259|PCP1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0008233 = Molecular function: peptidase activity
GO:0005515 = Molecular function: protein binding
GO:0045041 = Biological process: protein import into mitochondrial intermembrane space
GO:0006465 = Biological process: signal peptide processing
GO:0000723 = Biological process: telomere maintenance

Sequence:
>Contig1017
TTGGCCAATACCATTACACAAGACCCCACAATGCTGCATCTTTTCACCCG
ATCGTGCACTACCATCTTGCTCAACACTTCCAAAACAACATGTATTCAGT
CAGCCTCCTCCAGGTTTGGCTTCCGGGTACTCCGGACCCAACGTCCTCGA
CCACGATTCTTCCAACACAATGCCTTCAAGCAATTCCCCAACCGAAAACT
TCCCCCACAATCGGGGAAACTAACTCTCAAGCCAGCAATAAACTCCTCCG
AAAACCTCCCTTCTAAACCCCAGCCTAAACTCCTCGATAGACTGAAAGCT
CAAGGGCAGTTATCCCAAGACGAGGCTCCCAGAGACCTCTCTTACTCCCA
ACGCCTCTTTGCACCGCTCGTCTTCACTCTTGCTGTTTGCGGAGGTTCTT
ACTATTTTGCTTTAACATGGACACCTCCCCCACTTGACGCCCGCATGTTC
CCGGCCTTGCCTCAGAGTGTGACGACCGTTGCTGCCATCATTGCTGCCAA
TGCTGCCGTCTGGTTTGCTTGGAAGATCCCGTTGCCCATATCTTGGAGGT
TCCTGAATAGGTACTTTCTTTGTGCACCTGCGTTACCGTATAGTGTAGGG
TTGCTGGGGAGTGTGTTTTCGCATCAGAGTTTGACGCATTTGGGCCTTAA
CATGTTTGCGTTGTATATCTTTGGGTCAACTCTCTGTGACCAAATCGGCC
GTGGCAATTTTCTTGGGCTGTACTTCTCCTCGGGGGT

Sequences in the Contig:

SY0AAA3YJ20FM1 SY0AAC8YD12FM1 SY0AAD1YL16FM1
SY0AAD34YP01FM1