Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1016
Length(NT) : 2661
Best Gene Model Blast : Link to GSTUMT00009270001 E-value : 0.0
Numbers of ESTs : 23

Blast Results:

Nr Definition: hypothetical protein SNOG_00220
Accession: ref|XP_001790911.1| Score: 2201 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: mgr:MGG_05865 Score: 1742 E_value: 0.0
KOG Definition:
Classification: [Extracellular structures].
Kog Number: KOG4726 Score: 133 E_value: 3e-08
PFAM Definition: Glyoxal_oxid_N, Glyoxal oxidase N-terminus. This family represents the N-terminus (approximately 300 residues) of a number of plant and fungal glyoxal oxidase enzymes. Glyoxal oxidase catalyses the oxidation of aldehydes to carboxylic acids, coupled with reduction of dioxygen to hydrogen peroxide. It is an essential component of the extracellular lignin degradation pathways of the wood-rot fungus Phanerochaete chrysosporium..
Pfam Number: pfam07250 Score: 377 E_value: 2e-36
Swissprot: Q9S8M0|LECT_SOLTU

Sequence:
>Contig1016
TTGGGGCACCACGCTCGTTGACCTACGGTAATCTTCTGCTGGAAGCCCCG
AGTTTCTGTTCGTTTTGCAGCAGGACTCTTTCTGACGACCGGTTTTCACC
ACATTCTCATTCGTTCATTCATTTTTTTCTTGTTGAGCCTTTTTCCGACA
AGGCCGTTTGAATTTATCACACTCGTTCAGTGCTCTTTCAAGCACAGCTT
AGCTCATTATGGTCACCACGAAGACCGCTCTCATCCTCTCGGCACTTTTC
GCCCATGGCGTCTTTGCGAATATCCCTTTCCCCGATCCCTATATCGAGTG
CGATCCTGGGGCTGCGGAGGAAAAGTGTTTGAGGGGACAATACTGCAGTG
AAGAGGATGAACTTTGCAAAAGTCCTGCCCCTCATGAACTCTTCCGTCGT
ATTGCTCGTCCCAATCCTATCCCTGCTCCCGGTGATTTCTCTGTTGATGG
GAGGTGTGGGCCTGCCAACGGCGGTTTGATCTGTAACCCGAACTCTCCCA
ATTATGTTGGAGGTTGTTGCTCACAAGCTGGATGGTGCGGAAACACCCCT
GCATACTGTGGCGCCGGGTGCATTTCTGGATGTACAAGTACTTCAGCGGG
TGGCGGTACTCCTGCTCCGACTGGTGGCGCTGCTCGCCCTGATGGCCGTT
GCGGAACGGAATTTGGTGGCGCTACTTGTGCTGGTTCTGCTTTTGGAACT
TGTTGCAGTCAGTACGGGTGGTGCGGCACCGGAGATGCATACTGTCTTCC
AGCCAATGGATGTCAGAGTGGGTGCACTGGCACCACTCCTACCACTTCTA
CCCCTCCTTCTGTCCCTCCTGCCACTGCCCCGACAACTACCAGCAGCACT
GGTGAGCCGGTTTTGGGGGCACCTTCTTCCACCGGTGTCAACCCCAACCC
CACTGGCATTCCTACCACTGATGGTACTTGCGGTGCCACTAATGCTGGAA
GAACCTGCGTTGGTTGGGACAAGGGAGAATGTTGTTCGATGTATGGTTTC
TGCGGTAATACTGATGCTCACTGTGGTGATGGATGTCAATCTGGTCCTTG
TAAGGCTGGTGGATCTCCGCCGGCTCCTGGGGCATCGCCGGCTCCTATTA
CCAATGGAGGAGAATTTACGATTATTGGTCAATCGGGTGTTCCTGCCATG
CACGCTGGTCTTCTTCCTAACGGTCGTGCCATCTTCTTGGACAAGGTCGA
GAATTACACTCAATTGAAGCTTCCTAACGGCCAATTCGCTTACTCTTCTG
AGTACAATCCTGATGACAACACTGTTGTTCCATTGGCTTACAATACCAAT
GCCTTCTGCGCCGGAGGTATCTTCCTTGCGAATGGAGATTTTGTTTCGCT
TGGTGGCAATGCACCACTGGATTTCATTGACCCTACAGTTACCAATGGCT
TCGACGCTATTCGTTACATCACCCGCTCCTCGAGTGACGCCTCTTTCAAC
GGTCAAAACTGGCGCGAGCCTGGAAACAAGTTGGCTAGCAACAGGTGGTA
TGCTTCGGCTCAGATTCTTGCCGACGGGAGAATATTTGTTGCCTCTGGAA
GTTTGAATGGACTGGATCCTACAGTTCCTGCAAACAACAACCCCACATAT
GAAATATTGAGTGCTGCTGGTGTCAGTAACGGAGTCAATGTCCCTATGGA
TATCTTGGTTGCTCACCAACCTTACTATATGTATCCTTTCATGCATCTTC
TCAAGAACGGAGAGTTGTTTGTCTTCACCGCCAAGTCATCACAAATCTTC
AACATTGGTACCAACTCTATCACCCGCCAAATGCCCGATTTGCCGGGAGA
TTTCCGCACATATCCCAACACCGGTGGTAGCGTCATGTTTCCTCTTACCA
GCGCCAATGGATGGAACACCAAGGTCATGATTTGTGGTGGTGGTCCTTAT
CAAGATATTACCGCCCCTACTGATCCCAGCTGCGGCGTTATTGCGCCCGA
GGATGCAAACCCTACCTGGGAGATGGATGCCATGCCTGAAGGACGTGGTA
TGGTCGAGGGTGTCTTGCTTCCTGATGGATCTGTCCTATGGCTCAATGGT
GCCAACCGTGGTGCTCAGGGATTCGAGCTTGCTACCAACCCAACCCTTGC
CGCCCTCCTTTATGAACCTACCAAGGCAAAGGGAGCACGCTGGACGCAAC
TTGCCTCTTCCACTATTCCTAGGCTGTATCACTCAGTTGCTCTCTTGTTG
CTTGATGGTACCGTTCTCGTCACCGGTAGCAACCCGCATGAAATGCCAAT
CCTGGAAACAAGGCCTGGAGTTGCCTTCATTACTGATTTCCGTGTCGAGA
GGTTCACACCTCCTTATCTTCAGGGTGCCAAGGCCACTCAGCGTCCGTCC
GCGATGGCCCTCTCGACTAAGAATCTTCCGGCCAACGGGTCTACTTTCAC
CATCTCATTCAATGCTGCTACCACTACCCAGGGCATTAAGGTCGCCCTTT
ACTATGGTGGCTTCGTTACCCATTCTGTTCACATGGGTCACCGCATGCTC
TTCCTCGACAATACTGGCTTCGTCGCTGGCACTGCAGCTCAAACTATTAC
CGTCACAATGCCCCCTAACAAGAATGTGGTGCCTCCTGGGCCCTATGTTG
TCTACGTTGTTGCAGATGGAACTCCATCCGTCGGTCAATTCGTGACTGTT
GTCTAGGTTTT

Sequences in the Contig:

SY0AAA12YO12FM1 SY0AAA28YG04FM1 SY0AAA2YN02FM1
SY0AAA30YN10FM1 SY0AAA35YN19FM1 SY0AAA3YJ16FM1
SY0AAA44YJ05FM1 SY0AAA46YC10FM1 SY0AAA46YJ19FM1
SY0AAA47YL24FM1 SY0AAA54YA15FM1 SY0AAA59YJ19FM1
SY0AAB16YB23FM1 SY0AAB19YI09FM1 SY0AAB31YC01FM1
SY0AAB38YN22FM1 SY0AAB40YI08FM1 SY0AAB50YD16FM1
SY0AAB52YC16FM1 SY0AAB54YO12FM1 SY0AAB57YD15FM1
SY0AAB58YL05FM1 SY0AAD28YG03FM1